From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1472 [new locus tag: SACOL_RS07510 ]
  • pan locus tag?: SAUPAN003878000
  • symbol: ebh
  • pan gene symbol?: ebh
  • synonym:
  • product: cell wall associated fibronectin-binding protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1472 [new locus tag: SACOL_RS07510 ]
  • symbol: ebh
  • product: cell wall associated fibronectin-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1479867..1511363
  • length: 31497
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    2881
    2941
    3001
    3061
    3121
    3181
    3241
    3301
    3361
    3421
    3481
    3541
    3601
    3661
    3721
    3781
    3841
    3901
    3961
    4021
    4081
    4141
    4201
    4261
    4321
    4381
    4441
    4501
    4561
    4621
    4681
    4741
    4801
    4861
    4921
    4981
    5041
    5101
    5161
    5221
    5281
    5341
    5401
    5461
    5521
    5581
    5641
    5701
    5761
    5821
    5881
    5941
    6001
    6061
    6121
    6181
    6241
    6301
    6361
    6421
    6481
    6541
    6601
    6661
    6721
    6781
    6841
    6901
    6961
    7021
    7081
    7141
    7201
    7261
    7321
    7381
    7441
    7501
    7561
    7621
    7681
    7741
    7801
    7861
    7921
    7981
    8041
    8101
    8161
    8221
    8281
    8341
    8401
    8461
    8521
    8581
    8641
    8701
    8761
    8821
    8881
    8941
    9001
    9061
    9121
    9181
    9241
    9301
    9361
    9421
    9481
    9541
    9601
    9661
    9721
    9781
    9841
    9901
    9961
    10021
    10081
    10141
    10201
    10261
    10321
    10381
    10441
    10501
    10561
    10621
    10681
    10741
    10801
    10861
    10921
    10981
    11041
    11101
    11161
    11221
    11281
    11341
    11401
    11461
    11521
    11581
    11641
    11701
    11761
    11821
    11881
    11941
    12001
    12061
    12121
    12181
    12241
    12301
    12361
    12421
    12481
    12541
    12601
    12661
    12721
    12781
    12841
    12901
    12961
    13021
    13081
    13141
    13201
    13261
    13321
    13381
    13441
    13501
    13561
    13621
    13681
    13741
    13801
    13861
    13921
    13981
    14041
    14101
    14161
    14221
    14281
    14341
    14401
    14461
    14521
    14581
    14641
    14701
    14761
    14821
    14881
    14941
    15001
    15061
    15121
    15181
    15241
    15301
    15361
    15421
    15481
    15541
    15601
    15661
    15721
    15781
    15841
    15901
    15961
    16021
    16081
    16141
    16201
    16261
    16321
    16381
    16441
    16501
    16561
    16621
    16681
    16741
    16801
    16861
    16921
    16981
    17041
    17101
    17161
    17221
    17281
    17341
    17401
    17461
    17521
    17581
    17641
    17701
    17761
    17821
    17881
    17941
    18001
    18061
    18121
    18181
    18241
    18301
    18361
    18421
    18481
    18541
    18601
    18661
    18721
    18781
    18841
    18901
    18961
    19021
    19081
    19141
    19201
    19261
    19321
    19381
    19441
    19501
    19561
    19621
    19681
    19741
    19801
    19861
    19921
    19981
    20041
    20101
    20161
    20221
    20281
    20341
    20401
    20461
    20521
    20581
    20641
    20701
    20761
    20821
    20881
    20941
    21001
    21061
    21121
    21181
    21241
    21301
    21361
    21421
    21481
    21541
    21601
    21661
    21721
    21781
    21841
    21901
    21961
    22021
    22081
    22141
    22201
    22261
    22321
    22381
    22441
    22501
    22561
    22621
    22681
    22741
    22801
    22861
    22921
    22981
    23041
    23101
    23161
    23221
    23281
    23341
    23401
    23461
    23521
    23581
    23641
    23701
    23761
    23821
    23881
    23941
    24001
    24061
    24121
    24181
    24241
    24301
    24361
    24421
    24481
    24541
    24601
    24661
    24721
    24781
    24841
    24901
    24961
    25021
    25081
    25141
    25201
    25261
    25321
    25381
    25441
    25501
    25561
    25621
    25681
    25741
    25801
    25861
    25921
    25981
    26041
    26101
    26161
    26221
    26281
    26341
    26401
    26461
    26521
    26581
    26641
    26701
    26761
    26821
    26881
    26941
    27001
    27061
    27121
    27181
    27241
    27301
    27361
    27421
    27481
    27541
    27601
    27661
    27721
    27781
    27841
    27901
    27961
    28021
    28081
    28141
    28201
    28261
    28321
    28381
    28441
    28501
    28561
    28621
    28681
    28741
    28801
    28861
    28921
    28981
    29041
    29101
    29161
    29221
    29281
    29341
    29401
    29461
    29521
    29581
    29641
    29701
    29761
    29821
    29881
    29941
    30001
    30061
    30121
    30181
    30241
    30301
    30361
    30421
    30481
    30541
    30601
    30661
    30721
    30781
    30841
    30901
    30961
    31021
    31081
    31141
    31201
    31261
    31321
    31381
    31441
    GTGAATTATCGTGATAAAATTCAAAAGTTTAGTATTCGTAAATATACAGTTGGTACATTT
    TCAACTGTCATTGCGACATTGGTATTTTTAGGATTCAATACATCACAAGCACATGCTGCT
    GAAACAAATCAACCAGCAAGCGTGGTTAAACAGAAACAACAAAGTAATAATGAACAGACT
    GAGAATCGAGAATCTCAAGTACAAAATTCTCAAAATTCACAAAATGGTCAATCATTATCT
    GCTACTCATGAAAATGAGCAACCAAATATTAGTCAAGCTAATTTAGTAGATCAAAAAGTA
    GCGCAATCATCTACTACTAATGATGAACAACCAGCATCTCAAAATGTAAATACAAAGAAA
    GATTCGGCAACGGCTGCGACAACACAACCAGATAAAGAACAAAGTAAGCATAAACAAAAC
    GAAAGTCAATCTGCTAATAAAAATGGAAACGACAATAGAGCGGCTCATGTAGAAAATCAT
    GAAGCAAATGTAGTAACAGCTTCAGATTCATCTGATAATGGTAACGTACAACATGACCGA
    AATGAATTACAAGCGTTTTTTGATGCAAATTATCATGATTATCGCTTTATTGACCGTGAA
    AATGCAGATTCTGGCACATTTAACTATGTAAAAGGCATTTTTGATAAGATTAATACGTTA
    TTAGGCAGTAATGATCCAATAAACAATAAAGACTTGCAACTTGCATACAAAGAATTGGAA
    CAAGCTGTTGCTTTAATTCGTACAATGCCTCAACGTCAACAGACTAGCCGACGTTCAAAT
    AGAATTCAAACGCGTTCGGTTGAGTCAAGAGCTGCAGAGCCTAGATCAGTATCAGACTAT
    CAAAATGCAAATTCATCATATTATGTTGAAAATGCTAATGATGGTTCGGGCTATCCTGTT
    GGTACATATATCAATGCTTCTAGTAAAGGGGCGCCATATAATTTACCAACTACACCATGG
    AATACATTGAAGGCCTCTGACTCAAAGGAAATTGCTCTTATGACAGCGAAACAAACTGGA
    GACGGGTACCAATGGGTTATTAAGTTTAATAAAGGACATGCTCCACATCAAAATATGATC
    TTTTGGTTTGCATTACCAGCAGACCAAGTGCCAGTAGGAAGAACTGACTTTGTAACAGTT
    AATTCAGATGGAACAAATGTACAATGGAGTCATGGAGCAGGAGCAGGTGCAAATAAACCA
    CTTCAACAAATGTGGGAATATGGAGTAAATGATCCTCATCGTTCACATGACTTTAAAATA
    AGAAATAGAAGTGGCCAAGTAATATATGACTGGCCAACTGTCCATATTTATTCTTTAGAA
    GATTTATCTAGAGCGAGTGATTATTTTAGTGAAGCTGGAGCGACACCTGCTACTAAAGCT
    TTTGGTAGACAAAATTTTGAATATATTAATGGTCAAAAACCTGCTGAATCACCGGGTGTT
    CCTAAAGTTTATACTTTCATCGGTCAAGGTGATGCAAGTTATACAATTTCATTTAAAACA
    CAAGGTCCAACTGTTAATAAATTGTACTATGCAGCAGGTGGGCGTGCTTTAGAGTACAAT
    CAATTATTTATGTACAGTCAACTATACGTCGAATCAACGCAAGACCATCAACAACGTCTT
    AATGGTTTAAGACAAGTGGTTAATCGTACATATCGCATAGGTACAACTAAACGTGTAGAA
    GTGAGTCAAGGAAATGTACAAACGAAAAAGGTATTAGAAAGTACAAACCTAAATATAGAT
    GATTTTGTTGATGATCCTTTAAGTTATGTTAAGACGCCGAGTAATAAAGTGTTAGGATTT
    TATTCGAATAATGCAAATACTAATGCTTTTAGACCGGGTGGAGCCCAACAATTAAATGAA
    TATCAATTAAGTCAATTATTTACTGATCAAAAATTACAAGAAGCAGCAAGAACTAGAAAC
    CCAATAAGATTAATGATTGGTTTCGACTATCCTGATGCTTATGGTAATAGTGAAACTTTA
    GTTCCTGTTAACTTAACGGTATTACCTGAAATCCAACATAATATTAAATTCTTTAAAAAT
    GACGATACTCAAAATATTGCTGAAAAACCATTTTCAAAACAAGCTGGGCATCCAGTTTTC
    TATGTATATGCAGGTAACCAAGGGAATGCTTCCGTGAATTTAGGTGGTAGCGTAACATCT
    ATTCAACCATTACGTATTAATTTAACAAGTAATGAGAATTTTACAGATAAAGATTGGCAA
    ATTACAGGTATTCCGCGTACATTACACATTGAAAACTCGACAAATAGACCTAATAATGCC
    AGAGAACGCAATATTGAACTTGTTGGTAACTTATTACCAGGGGATTACTTTGGAACGATA
    CGTTTTGGACGTAAAGAACAATTATTCGAAATTCGTGTTAAACCACATACACCAACAATT
    ACAACGACAGCTGAGCAATTAAGAGGTACAGCATTACAAAAAGTGCCTGTTAATATTTCG
    GGAATACCGTTGGATCCATCGGCATTGGTTTATTTAGTTGCACCAACAAATCAAACTACG
    AATGGTGGTAGTGAGGCAGATCAAATACCATCTGGTTATACGATACTTGCGACTGGTACA
    CCTGATGGGGTGCATAATACAATTACTATACGACCGCAAGATTATGTTGTATTCATACCA
    CCTGTAGGTAAACAAATTAGAGCAGTAGTTTATTATAATAAAGTAGTTGCATCTAATATG
    AGTAATGCTGTTACTATTTTGCCAGATGACATTCCACCAACAATCAATAATCCTGTTGGA
    ATAAATGCCAAATACTATCGAGGCGACGAAGTCAACTTTACAATGGGTGTCTCTGATAGA
    CATTCTGGTATAAAAAATACAACTATTACGACATTGCCGAATGGTTGGACATCAAATTTA
    ACAAAAGCGGATAAGAATAATGGCTCATTATCTATTACAGGTAGAGTGAGTATGAATCAG
    GCATTTAACAGTGATATTACATTTAAAGTGTCAGCGACAGACAATGTCAATAATACGACA
    AATGATAGTCAATCTAAACATGTTTCAATTCATGTAGGTAAAATTAGTGAAGATGCTCAT
    CCGATTGTATTAGGAAATACTGAGAAAGTTGTAGTAGTCAATCCGACTGCTGTATCTAAT
    GATGAAAAGCAAAGCATAATTACTGCCTTTATGAATAAAAACCAAAATATAAGAGGATAT
    TTAGCATCAACTGATCCAGTAACTGTCGATAATAATGGTAATGTCACATTACATTACCGT
    GATGGCTCATCGACAACGCTTGATGCTACAAATGTGATGACATACGAACCAGTTGTGAAA
    CCTGAATACCAAACTGTCAATGCTGCTAAAACAGCAACGGTAACGATTGCTAAAGGACAA
    TCATTTAGTATTGGTGATATTAAACAATATTTTACTTTAAGTAATGGACAACCTATTCCA
    AGTGGCACATTTACAAATATTACATCTGATAGAACTATTCCAACTGCACAAGAAGTTAGT
    CAAATGAACGCAGGCACGCAGTTATACCATATAACTGCTACAAATGCGTATCATAAAGAT
    AGTGAAGACTTCTATATTAGTTTGAAAATCATCGATGTGAAACAACCAGAAGGCGATCAA
    CGTGTATATCGTACATCAACATATGATTTAACTACTGATGAAATCTCAAAAGTAAAACAA
    GCATTTATTAATGCAAATAGAGATGTAATTACGCTTGCCGAAGGTGATATTTCAGTTACA
    AATACACCTAATGGTGCTAATGTAAGTACTATTACAGTAAATATTAATAAAGGTCGATTA
    ACGAAATCATTCGCGTCAAACCTAGCTAATATGAATTTCTTGCGTTGGGTTAATTTCCCA
    CAAGATTATACAGTGACATGGACGAATGCAAAAATTGCAAACAGACCAACAGATGGTGGT
    TTATCATGGTCTGATGACCATAAATCTTTAATTTATCGTTATGATGCTACATTAGGTACT
    CAAATTACGACGAATGATATTTTAACAATGTTAAAAGCAACAACTACAGTGCCTGGATTG
    CGAAATAACATTACTGGTAATGAAAAATCACAAGCAGAAGCTGGCGGAAGACCTAACTTT
    AGAACGACTGGTTATTCACAATCAAATGCGACAACTGATGGTCAACGTCAATTTACGTTG
    AATGGTCAAGTGATTCAAGTGTTAGACATCATCAACCCTTCAAACGGTTATGGTGGGCAA
    CCTGTTACAAATTCAAATACTCGTGCAAACCATAGTAACTCAACTGTTGTTAACGTAAAC
    GAACCGGCAGCTAATGGTGCTGGCGCATTTACAATTGACCACGTTGTAAAAAGTAATTCT
    ACACATAATGCAAGTGATGCAGTTTATAAAGCACAGTTATACTTAACGCCATATGGTCCA
    AAACAATATGTTGAACATTTAAATCAAAATACAGGAAATACTACTGACGCTATTAACATT
    TATTTTGTACCAAGTGACTTAGTGAATCCAACAATTTCAGTAGGTAATTACACTAATCAT
    CAAGTGTTCTCAGGTGAAACATTTACAAATACTATTACAGCGAATGATAACTTTGGTGTG
    CAATCTGTAACTGTACCAAATACATCACAAATTACAGGTACTGTTGATAATAACCATCAA
    CATGTTTCTGCAACGGCACCAAATGTGACATCAGCAACTAATAAGACAATCAATTTATTA
    GCAACTGATACAAGCGGCAATACAGCTACAACTTCGTTCAATGTAACAGTGAAACCTTTG
    CGTGATAAATATCGAGTTGGTACTTCATCAACGGCTGCTAATCCTGTGAGAATTGCCAAT
    ATTTCGAATAATGCGACAGTATCACAAGCTGATCAAACGACAATTATTAATTCGTTAACG
    TTTACTGAAACAGTACCAAATAGAAGTTATGCAAGAGCAAGTGCGAATGAAATCACTAGT
    AAAACAGTTAGTAATGTCAGTCGTACTGGAAATAATGCCAATGTCACAGTAACTGTTACT
    TATCAAGATGGAACAACATCAACAGTGACTGTACCTGTAAAGCATGTCATTCCAGAAATC
    GTTGCACATTCGCATTACACTGTACAAGGCCAAGACTTCCCAGCAGGTAATGGTTCTAGT
    GCATCAGATTACTTTAAGTTATCTAATGGTAGTGACATTGCAGATGCAACTATTACATGG
    GTAAGTGGACAAGCGCCAAATAAAGATAATACACGTATTGGTGAAGATATAACTGTAACT
    GCACATATCTTAATTGATGGCGAAACAACGCCGATTACGAAAACAGCAACATATAAAGTA
    GTAAGAACTGTACCGAAACATGTCTTTGAAACAGCCAGAGGTGTTTTATACCCAGGTGTT
    TCAGATATGTATGATGCGAAACAATATGTTAAGCCAGTAAATAATTCTTGGTCGACAAAT
    GCGCAACATATGAATTTCCAATTTGTTGGAACATATGGTCCTAACAAAGATGTTGTAGGC
    ATATCTACTCGTCTTATTAGAGTGACATATGATAATAGACAAACAGAAGATTTAACTATT
    TTATCTAAAGTTAAACCTGACCCACCTAGAATTGACGCAAACTCTGTGACATATAAAGCA
    GGTCTTACAAACCAAGAAATTAAAGTTAATAACGTATTAAATAACTCGTCAGTAAAATTA
    TTTAAAGCAGATAATACACCATTAAATGTCACAAATATTACTCATGGTAGCGGTTTTAGT
    TCGGTTGTGACAGTAAGTGACGCGTTACCAAATGGCGGAATTAAAGCAAAATCTTCAATT
    TCAATGAACAATGTGACGTATACGACGCAAGACGAACATGGTCAAGTTGTTACAGTAACA
    AGAAATGAATCTGTTGATTCAAATGACAGTGCAACAGTAACAGTGACACCACAATTACAA
    GCAACTACTGAAGGCGCTGTATTTATTAAAGGTGGCGACGGTTTTGATTTCGGACACGTA
    GAAAGATTTATTCAAAACCCGCCACATGGGGCAACGGTTGCATGGCATGATAGTCCAGAT
    ACATGGAAGAATACAGTCGGTAACACTCATAAAACTGCGGTTGTAACATTACCTAATGGT
    CAAGGTACGCGTAATGTTGAAGTTCCAGTCAAAGTTTATCCAGTTGCTAATGCAAAGGCG
    CCATCACGTGATGTGAAAGGTCAAAATTTGACTAATGGAACGGATGCGATGAACTACATT
    ACATTTGATCCAAATACAAACACAAATGGTATCACTGCAGCATGGGCAAATAGACAACAA
    CCAAATAACCAACAAGCAGGCGTGCAACATTTAAATGTCGATGTCACATATCCAGGTATT
    TCAGCTGCTAAACGAGTTCCTGTTACTGTTAATGTATATCAATTTGAATTCCCTCAAACT
    ACTTATACGACAACGGTTGGAGGCACTTTAGCAAGTGGTACGCAAGCATCAGGATATGCA
    CATATGCAAAATGCTACTGGTTTACCAACAGATGGATTTACGTATAAATGGAATCGTGAT
    ACTACAGGTACAAATGACGCAAACTGGTCAGCTATGAATAAACCGAATGTGGCTAAAGTC
    GTTAACGCAAAATATGACGTCATCTATAACGGACATACTTTTGCAACATCTTTACCAGCG
    AAATTTGTAGTAAAAGATGTGCAACCAGCGAAACCAACTGTGACTGAAACAGCGGCAGGA
    GCGATTACAATTGCACCTGGAGCAAACCAAACAGTGAATACACATGCCGGTAACGTAACG
    ACATACGCTGATAAATTAGTTATTAAACGTAATGGTAACGTTGTGACGACATTTACACGT
    CGCAATAATACGAGTCCATGGGTGAAAGAAGCATCTGCAGCAACTGTAGCAGGTATTGCT
    GGAACTAATAATGGTATTACTGTTGCAGCAGGTACTTTCAACCCTGCTGATACAATTCAA
    GTTGTTGCAACGCAAGGAAGCGGAGAGACAGTGAGTGATGAGCAACGTAGTGATGATTTC
    ACAGTTGTCGCACCACAACCGAACCAAGCGACTACTAAGATTTGGCAAAATGGTCATATT
    GATATCACGCCTAATAATCCATCAGGACATTTAATTAATCCAACTCAAGCAATGGATATT
    GCTTACACTGAAAAAGTGGGTAATGGTGCAGAACATAGTAAGACAATTAATGTTGTTCGT
    GGTCAAAATAATCAATGGACAATTGCGAATAAGCCTGACTATGTAACGTTAGATGCACAA
    ACTGGTAAAGTGACGTTCAATGCCAATACTATAAAACCAAATTCATCAATCACAATTACT
    CCGAAAGCAGGTACAGGTCACTCAGTAAGTAGTAATCCAAGTACATTAACTGCACCGGCA
    GCTCATACTGTCAACACAACTGAAATTGTGAAAGATTATGGTTCAAATGTAACAGCAGCT
    GAAATTAACAATGCAGTTCAAGTTGCTAATAAACGTACTGCAACGATTAAAAATGGCACA
    GCAATGCCTACTAATTTAGCTGGTGGTAGCACAACGACGATTCCTGTGACAGTAACTTAC
    AATGATGGTAGTACTGAAGAAGTACAAGAGTCCATTTTCACAAAAGCGGATAAACGTGAG
    TTAATCACAGCTAAAAATCATTTAGATGATCCAGTAAGCACTGAAGGTAAAAAGCCAGGT
    ACAATTACGCAGTACAATAATGCAATGCATAATGCGCAACAACAAATCAATACTGCGAAA
    ACAGAAGCACAACAAGTGATTAATAATGAGCGTGCAACACCACAACAAGTTTCTGACGCA
    CTAACTAAAGTTCGTGCAGCACAAACTAAGATTGATCAAGCTAAAGCATTACTTCAAAAT
    AAAGAAGATAATAGCCAATTAGTAACGTCTAAAAATAACTTACAAAGTTCTGTGAACCAA
    GTACCATCAACTGCTGGTATGACGCAACAAAGTATTGATAACTATAATGCGAAGAAGCGT
    GAAGCAGAAACTGAAATAACTGCAGCTCAACGTGTTATTGACAATGGCGATGCAACTGCA
    CAACAAATTTCAGATGAAAAACATCGTGTCGATAACGCATTAACAGCATTAAACCAAGCG
    AAACATGATTTAACTGCAGATACACATGCCTTAGAGCAAGCAGTGCAACAATTGAATCGC
    ACAGGTACAACGACTGGTAAGAAGCCGGCAAGTATTACTGCTTACAATAATTCGATTCGT
    GCACTTCAAAGTGACTTAACAAGTGCTAAAAATAGCGCTAATGCTATTATTCAAAAGCCA
    ATAAGAACAGTACAAGAAGTGCAATCTGCGTTAACAAATGTAAATCGTGTCAATGAGCGA
    TTAACGCAAGCAATTAATCAATTAGTACCTTTAGCTGATAATAGTGCTTTAAAAACTGCT
    AAGACGAAACTTGATGAAGAAATCAATAAATCAGTAACTACTGATGGTATGACACAATCA
    TCAATCCAAGCATATGAAAATGCTAAACGTGCGGGTCAAACAGAATCAACAAATGCACAA
    AATGTTATTAACAATGGTGATGCGACTGACCAACAAATTGCCGCAGAAAAAACAAAAGTA
    GAAGAAAAATATAATAGCTTAAAACAAGCAATTGCTGGATTAACTCCAGACTTGGCACCA
    TTACAAACTGCAAAAACTCAGTTGCAAAATGATATTGATCAGCCAACGAGTACGACTGGT
    ATGACAAGCGCATCTATTGCAGCATTTAATGAAAAACTTTCAGCAGCTAGAACTAAAATT
    CAAGAAATTGATCGTGTATTAGCCTCACATCCAGATGTTGCGACAATACGTCAAAACGTG
    ACAGCAGCGAATGCCGCTAAATCAGCACTTGATCAAGCACGTAATGGCTTAACAGTCGAT
    AAAGCGCCTTTAGAAAATGCGAAAAATCAACTACAATATAGTATTGACACGCAAACAAGT
    ACAACTGGTATGACACAAGACTCTATAAATGCATACAATGCGAAGTTAACAGCTGCACGT
    AATAAGATTCAACAAATCAATCAAGTATTAGCAGGTTCACCGACTGTAGAACAAATTAAT
    ACAAATACGTCTACAGCAAATCAAGCTAAATCTGATTTAGATCATGCACGTCAAGCTTTA
    ACACCAGATAAAGCGCCGCTTCAAACTGCGAAAACGCAATTAGAACAAAGCATTAATCAA
    CCAACGGATACAACAGGTATGACGACCGCTTCGTTAAATGCGTACAACCAAAAATTACAA
    GCAGCGCGTCAAAAGTTAACTGAAATTAATCAAGTGTTGAATGGCAACCCAACTGTCCAA
    AATATCAATGATAAAGTGACAGAGGCAAACCAAGCTAAGGATCAATTAAATACAGCACGT
    CAAGGTTTAACATTAGATAGACAGCCAGCGTTAACAACATTACATGGTGCATCTAACTTA
    AACCAAGCACAACAAAATAATTTCACGCAACAAATTAATGCTGCTCAAAATCATGCTGCG
    CTTGAAACAATTAAGTCTAACATTACGGCTTTAAATACTGCGATGACGAAATTAAAAGAC
    AGTGTTGCGGATAATAATACAATTAAATCAGATCAAAATTACACTGACGCAACACCAGCT
    AATAAACAAGCGTATGATAATGCAGTTAATGCGGCTAAAGGTGTCATTGGAGAAACGACT
    AATCCAACGATGGATGTTAACACAGTGAACCAAAAAGCAGCATCTGTTAAATCGACGAAA
    GATGCTTTAGATGGTCAACAAAACTTACAACGTGCGAAAACAGAAGCAACAAATGCGATT
    ACGCATGCAAGTGATTTAAACCAAGCACAAAAGAATGCATTAACACAACAAGTGAATAGT
    GCACAAAACGTGCAAGCAGTAAATGATATTAAACAAACGACTCAAAGCTTAAATACTGCT
    ATGACAGGTTTAAAACGTGGCGTTGCTAATCATAACCAAGTCGTACAAAGTGATAATTAT
    GTCAACGCAGATACTAATAAGAAAAATGATTACAACAATGCATACAACCATGCGAATGAC
    ATTATTAATGGTAATGCACAACATCCAGTTATAACACCAAGTGATGTTAACAATGCTTTA
    TCAAATGTCACAAGTAAAGAACATGCATTGAATGGTGAAGCTAAGTTAAATGCTGCGAAA
    CAAGAAGCGAATACTGCATTAGGTCATTTAAACAATTTAAATAATGCACAACGTCAAAAC
    TTACAATCGCAAATTAATGGTGCGCATCAAATTGATGCAGTTAATACAATTAAGCAAAAT
    GCAACAAACTTGAATAGTGCAATGGGTAACTTAAGACAAGCTGTTGCAGATAAAGATCAA
    GTGAAACGTACAGAAGATTATGCGGATGCAGATACAGCTAAACAAAATGCATATAACAGT
    GCAGTTTCAAGTGCCGAAACAATCATTAATCAAACAACAAATCCAACGATGTCTGTTGAT
    GATGTTAATCGTGCAACTTCAGCTGTTACTTCTAATAAAAATGCATTAAATGGTTATGAA
    AAATTAGCACAATCTAAAACAGATGCTGCAAGAGCAATTGATGCATTACCACATTTAAAT
    AATGCACAAAAAGCAGATGTTAAATCTAAAATTAATGCTGCATCAAATATTGCTGGCGTA
    AATACTGTTAAACAACAAGGTACAGATTTAAATACAGCGATGGGTAACTTGCAAGGTGCA
    ATCAATGATGAACAAACGACGCTTAATAGTCAAAACTATCAAGATGCGACACCTAGTAAG
    AAAACAGCATACACAAATGCGGTACAAGCTGCGAAAGATATTTTAAATAAATCAAATGGT
    CAAAATAAAACGAAAGATCAAGTTACTGAAGCGATGAATCAAGTGAATTCTGCTAAAAAT
    AACTTAGATGGTACGCGTTTATTAGATCAAGCGAAGCAAACAGCAAAACAGCAGTTAAAT
    AATATGACGCATTTAACAACTGCACAAAAAACGAATTTAACAAACCAAATTAATAGTGGT
    ACTACTGTCGCTGGTGTTCAAACGGTTCAATCAAATGCCAATACATTAGATCAAGCCATG
    AATACGTTAAGACAAAGTATTGCCAACAAAGATGCGACTAAAGCAAGTGAAGATTACGTA
    GATGCTAATAATGATAAGCAAACAGCATATAACAACGCAGTAGCTGCTGCTGAAACGATT
    ATTAATGCTAATAGTAATCCAGAAATGAATCCAAGTACGATTACACAAAAAGCAGAGCAA
    GTGAATAGTTCTAAAACGGCACTTAACGGTGATGAAAACTTAGCTGCTGCAAAACAAAAT
    GCGAAAACGTACTTAAACACATTGACAAGTATTACAGATGCTCAAAAGAACAATTTGATT
    AGTCAAATTACTAGTGCGACAAGAGTGAGTGGTGTTGATACTGTAAAACAAAATGCGCAA
    CATCTAGACCAAGCTATGGCTAGCTTACAGAATGGTATTAACAACGAATCTCAAGTGAAA
    TCATCTGAGAAATATCGTGATGCTGATACAAATAAACAACAAGAGTATGATAATGCTATT
    ACTGCAGCGAAAGCGATTTTAAATAAATCGACAGGTCCAAACACTGCGCAAAATGCAGTT
    GAAGCAGCATTACAACGTGTTAATAATGCGAAAGATGCATTGAATGGTGATGCAAAATTA
    ATTGCAGCTCAAAACGCAGCGAAACAACATTTAGGTACTTTAACGCATATCACTACAGCT
    CAACGTAATGATTTAACAAATCAAATTTCACAAGCTACAAACTTAGCTGGTGTTGAATCT
    GTTAAACAAAATGCGAATAGTTTAGATGGTGCTATGGGTAACTTACAAACGGCTATCAAC
    GATAAGTCAGGAACATTAGCGAGCCAAAACTTCTTGGATGCTGATGAGCAAAAACGTAAT
    GCATACAATCAAGCTGTATCAGCAGCCGAAACCATTTTAAATAAACAAACTGGACCGAAT
    ACAGCGAAAACAGCAGTCGAACAAGCACTTAATAATGTTAATAATGCGAAACATGCATTA
    AATGGTACGCAAAACTTAAACAATGCGAAACAAGCAGCGATTACAGCAATCAATGGCGCA
    TCTGATTTAAATCAAAAACAAAAAGATGCATTAAAAGCACAAGCTAATGGTGCTCAACGC
    GTATCTAATGCACAAGATGTACAGCACAATGCGACTGAACTGAACACGGCAATGGGCACA
    TTAAAACATGCCATCGCAGATAAGACGAATACGTTAGCAAGCAGTAAATATGTTAATGCC
    GATAGCACTAAACAAAATGCTTACACAACTAAAGTTACCAATGCTGAACATATTATTAGC
    GGTACGCCAACGGTTGTTACGACACCTTCAGAAGTAACAGCTGCAGCTAATCAAGTAAAC
    AGCGCGAAACAAGAATTAAATGGTGACGAAAGATTACGTGAAGCAAAACAAAACGCCAAT
    ACTGCTATTGATGCATTAACACAATTAAATACACCTCAAAAAGCTAAATTAAAAGAACAA
    GTGGGACAAGCCAATAGATTAGAAGACGTACAAACTGTTCAAACAAATGGACAAGCATTG
    AACAATGCAATGAAAGGCTTAAGAGATAGTATTGCTAACGAAACAACAGTCAAAACAAGT
    CAAAACTATACAGACGCAAGTCCGAATAACCAATCAACATATAATAGCGCTGTGTCAAAT
    GCGAAAGGTATCATTAATCAAACTAACAATCCGACTATGGATACTAGTGCGATTACCCAA
    GCTACAACACAAGTGAATAATGCTAAAAATGGTTTAAACGGTGCTGAAAACTTAAGAAAT
    GCACAAAACACTGCTAAGCAAAACTTAAATACATTATCACACTTAACAAATAACCAAAAA
    TCTGCCATCTCATCACAAATTGATCGTGCAGGTCATGTGAGTGAGGTAACTGCTACTAAA
    AATGCAGCAACTGAGTTGAATACGCAAATGGGTAACTTGGAACAAGCTATCCATGATCAA
    AACACAGTTAAACAAAGTGTTAAATTTACTGATGCAGATAAAGCTAAACGTGATGCGTAT
    ACAAATGCGGTAAGCAGAGCTGAAGCAATTCTGAATAAAACGCAAGGTGCAAATACGTCT
    AAACAAGATGTTGAAGCGGCTATTCAAAATGTTTCAAGTGCTAAAAATGCATTGAATGGT
    GATCAAAACGTTACAAATGCGAAGAATGCAGCTAAAAATGCATTAAATAACTTAACGTCA
    ATTAATAATGCACAAAAACGTGACTTAACAACTAAAATTGATCAAGCAACAACTGTAGCT
    GGTGTTGAAGCTGTATCTAATACGAGTACACAATTGAATACAGCGATGGCTAACTTGCAA
    AATGGTATTAATGATAAAACAAATACACTAGCAAGTGAAAACTATCATGATGCTGATTCA
    GATAAGAAAACTGCTTATACTCAAGCCGTTACGAACGCAGAAAATATTTTAAATAAAAAT
    AGTGGATCAAATTTAGACAAAACTGCCGTTGAAAACGCGTTGTCACAAGTTGCTAATGCG
    AAAGGTGCCCTAAATGGTAACCATAATTTAGAGCAAGCTAAATCAAATGCAAACACTACT
    ATAAACGGACTTCAACATTTAACAACTGCTCAAAAAGATAAATTGAAACAACAAGTGCAA
    CAAGCACAAAATGTTGCAGGTGTAGATACTGTTAAATCAAGTGCCAACACATTAAATGGT
    GCTATGGGTACGTTAAGAAATAGCATACAAGATAACACAGCTACGAAAAATGGCCAAAAC
    TATCTTGATGCTACAGAACGTAACAAAACAAACTATAACAATGCTGTTGATAGTGCTAAT
    GGTGTCATTAATGCAACAAGCAATCCAAATATGGATGCTAATGCAATTAACCAAATCGCT
    ACACAAGTGACATCAACGAAAAATGCATTAGATGGTACACATAATTTAACGCAAGCGAAA
    CAAACAGCAACAAATGCCATCGATGGTGCTACTAACTTAAATAAAGCGCAAAAAGATGCG
    TTAAAAGCACAAGTTACAAGTGCGCAACGTGTTGCAAATGTAACAAGTATCCAACAAACT
    GCAAATGAACTTAATACAGCTATGGGTCAATTACAACATGGTATTGATGATGAAAATGCA
    ACAAAACAAACTCAAAAATATCGTGACGCTGAACAAAGTAAGAAAACTGCTTATGATCAA
    GCTGTAGCTGCTGCGAAAGCAATTTTAAATAAACAAACAGGTTCAAATTCAGATAAAGCA
    GCAGTTGACCGTGCATTACAACAAGTAACAAGTACGAAAGATGCATTGAATGGTGATGCA
    AAACTGGCAGAAGCGAAAGCGGCAGCTAAACAAAACTTAGGCACTTTAAACCATATTACG
    AATGCACAACGTACTGACTTAGAAGGCCAAAACAATCAAGCGACGACTGTTGATGGCGTT
    AATACTGTAAAAACAAATGCCAATACATTAGACGGCGCAATGAATAGCTTACAAGGTTCA
    ATCAATGATAAAGATGCGACATTAAGAAATCAAAATTATCTTGATGCGGATGAATCAAAA
    CGAAATGCATATACGCAAGCTGTCACAGCGGCTGAAGGCATTTTAAATAAACAAACTGGT
    GGTAACACATCTAAAGCAGACGTTGATAATGCATTAAATGCAGTTACAAGAGCGAAAGCG
    GCTTTAAATGGTGCTGACAACTTAAGAAATGCGAAAACTTCAGCAACAAATACGATTGAT
    GGTTTACCTAACTTAACACAATTACAAAAAGACAACTTGAAGCATCAAGTTGAACAAGCG
    CAAAATGTAGCAGGTGTAAATGGTGTTAAAGATAAAGGTAATACGTTAAATACTGCCATG
    GGTGCATTACGTACAAGTATCCAAAATGATAATACGACGAAAACAAGTCAAAATTATCTT
    GATGCATCTGACAGCAACAAAAATAATTACAATACTGCTGTAAATAATGCAAATGGTGTT
    ATTAATGCAACGAACAATCCAAATATGGATGCTAATGCGATTAATGGCATGGCAAATCAA
    GTCAATACAACAAAAGCAGCGTTAAATGGTGCACAAAACTTAGCTCAAGCTAAAACAAAT
    GCGACGAACACAATTAACAACGCACATGACTTAAACCAAAAACAAAAAGATGCATTAAAA
    ACACAAGTTAACAATGCACAACGTGTATCTGATGCAAATAACGTTCAACACACTGCAACT
    GAATTGAACAGTGCGATGACAGCACTTAAAGCAGCTATTGCTGATAAAGAAAGAACAAAA
    GCAAGCGGTAATTATGTCAATGCTGATCAAGAAAAACGTCAAGCGTATGATTCAAAAGTG
    ACTAACGCTGAAAATATCATTAGTGGTACACCGAATGCGACATTAACAGTCAATGACGTA
    AATAGTGCGGCATCACAAGTCAATGCGGCTAAAACAGCATTAAATGGTGATAACAACTTA
    CGTGTAGCGAAAGAGCATGCCAACAATACAATTGACGGCTTAGCACAATTGAATAATGCA
    CAAAAAGCAAAATTAAAAGAACAAGTTCAAAGTGCAACTACATTAGATGGTGTTCAAACT
    GTTAAAAATAGTTCTCAAACGTTGAATACAGCGATGAAAGGCTTAAGAGATAGTATTGCG
    AATGAAGCAACAATTAAAGCAGGTCAAAACTACACTGACGCAAGTCCAAATAATCGTAAC
    GAGTACGACAGTGCAGTTACTGCAGCAAAAGCAATCATTAATCAAACATCGAACCCAACG
    ATGGAACCAAATACTATTACGCAAGTAACATCACAAGTGACAACTAAAGAACAGGCATTA
    AATGGTGCGCGAAACTTAGCTCAAGCTAAGACAACTGCGAAAAACAACTTGAATAACTTA
    ACATCAATTAACAATGCACAAAAAGATGCGTTAACGCGTAGCATTGATGGTGCAACAACA
    GTAGCTGGTGTAAATCAAGAAACTGCAAAAGCAACAGAATTAAATAACGCAATGCATAGT
    TTACAAAATGGTATCAATGATGAGACACAAACAAAACAAACTCAGAAATACCTAGATGCA
    GAGCCAAGTAAGAAATCAGCTTATGATCAAGCAGTAAATGCAGCGAAAGCAATTTTAACA
    AAAGCTAGTGGTCAAAATGTAGACAAAGCAGCAGTTGAACAAGCATTGCAAAATGTGAAC
    AGTACGAAGACGGCGTTGAACGGTGATGCGAAATTAAATGAAGCTAAAGCAGCTGCGAAA
    CAAACGTTAGGTACATTAACACACATTAATAATGCACAACGTACAGCGTTAGACAATGAA
    ATTACACAAGCAACAAATGTTGAAGGTGTTAATACAGTTAAAGCCAAAGCGCAACAATTA
    GATGGTGCTATGGGTCAATTAGAAACATCAATTCGTGATAAAGACACGACGTTACAAAGT
    CAAAATTATCAAGATGCTGATGATGCTAAACGAACTGCTTATTCTCAAGCAGTAAATGCA
    GCAGCAACTATTTTAAATAAAACAGCTGGCGGTAATACACCTAAAGCAGATGTTGAAAGA
    GCAATGCAAGCTGTTACACAAGCAAATACTGCATTAAACGGTATTCAAAACTTAGATCGT
    GCGAAACAGGCTGCTAACACAGCGATTACAAATGCTTCGGACTTAAATACAAAACAAAAA
    GAAGCATTAAAAGCACAAGTAACAAGTGCAGGACGTGTATCTGCAGCAAATGGTGTTGAA
    CATACTGCGACTGAATTAAATACTGCGATGACAGCTTTAAAGCGTGCCATTGCTGATAAA
    GCTGAGACAAAAGCTAGTGGTAACTATGTCAATGCTGATGCGAATAAACGTCAAGCATAT
    GATGAAAAAGTTACAGCTGCCGAAAATATCGTTAGTGGTACACCAACACCAACGTTAACA
    CCAGCAGATGTTACAAATGCAGCAACGCAAGTAACGAATGCTAAGACGCAGTTAAACGGT
    AATCATAATTTAGAAGTAGCGAAACAAAATGCTAACACTGCAATTGATGGTTTAACTTCT
    TTAAATGGTCCGCAAAAAGCAAAACTTAAAGAACAAGTGGGTCAAGCGACGACGTTGCCA
    AATGTTCAAACTGTTCGTGATAATGCACAAACATTAAACACTGCAATGAAAGGTCTACGA
    GATAGCATTGCGAATGAAGCAACGATTAAAGCAGGTCAAAACTACACAGATGCAAGTCAA
    AACAAACAAACTGACTACAACAGTGCAGTCACTGCAGCAAAAGCAATCATTGGTCAAACA
    ACTAGTCCATCAATGAATGCGCAAGAAATTAATCAAGCGAAAGACCAAGTGACAGCTAAA
    CAACAAGCGTTAAACGGTCAAGAAAACTTAAGAACTGCGCAAACAAATGCGAAGCAACAT
    TTGAACGGCTTAAGTGACTTAACTGACGCTCAAAAAGATGCAGTGAAACGTCAAATCGAA
    GGTGCAACGCATGTTAATGAAGTAACACAAGCACAAAATAATGCGGATGCATTAAATACA
    GCTATGACGAACTTGAAAAATGGTATTCAAGATCAGAATACGATTAAGCAAGGTGTTAAC
    TTCACTGATGCCGACGAAGCGAAACGTAATGCATATACAAATGCAGTGACGCAAGCTGAA
    CAAATTTTAAATAAAGCACAAGGTCCAAATACTTCAAAAGACGGTGTCGAAACTGCGTTA
    GAAAATGTACAACGTGCTAAAAACGAATTGAACGGTAATCAAAATGTTGCGAACGCTAAG
    ACAACTGCGAAAAATGCATTGAATAACCTAACATCAATTAATAATGCACAAAAAGAAGCA
    TTGAAATCACAAATTGAAGGTGCGACAACAGTTGCAGGTGTAAATCAAGTGTCTACAACG
    GCATCTGAATTAAATACAGCAATGAGCAACTTACAAAATGGTATTAATGATGAAGCAGCT
    ACAAAAGCAGCTCAGAAATATACTGATGCAGATAGAGAAAAACAAACTGCATACAATGAC
    GCTGTAACAGCAGCTAAAACGTTATTAGATAAAACAGCTGGTTCAAATGACAATAAAGCA
    GCTGTTGAACAAGCATTACAACGTGTGAATACTGCTAAAACAGCATTAAATGGTGACGAG
    CGATTAAATGAAGCGAAGAACACAGCTAAACAACAAGTAGCGACAATGTCACACTTAACT
    GATGCTCAAAAAGCAAACTTAACATCGCAAATCGAAAGTGGTACGACTGTTGCAGGTGTT
    CAAGGTATTCAAGCTAATGCCGGTACTTTAGATCAAGCAATGAATCAATTAAGACAAAGT
    ATTGCTTCTAAAGATGCGACTAAATCAAGCGAAGATTATCAAGACGCGAATGCAGATTTA
    CAAAATGCATACAATGATGCGGTAACTAATGCTGAAGGTATTATTAGTGCAACGAATAAC
    CCTGAAATGAATCCTGATACAATTAACCAAAAAGCGAGCCAAGTGAACAGTGCGAAGTCT
    GCATTGAACGGTGATGAAAAATTAGCAGCAGCAAAACAAACTGCGAAATCAGATATCGGT
    CGTTTGACAGACTTGAACAATGCACAACGAACTGCGGCAAATGCTGAAGTGGATCAAGCA
    CCAAATCTTGCAGCTGTCACAGCGGCTAAAAATAAAGCAACATCGTTAAATACAGCGATG
    GGTAATTTGAAACATGCACTTGCTGAAAAGGATAATACGAAACGTAGTGTCAATTACACA
    GATGCGGATCAACCAAAACAACAAGCGTATGATACTGCGGTTACACAAGCAGAAGCAATT
    ACTAATGCTAATGGCAGCAACGCGAATGAAACACAAGTTCAAGCAGCACTAAACCAATTG
    AATCAAGCTAAAAATGACTTGAATGGTGATAATAAAGTTGCTCAAGCAAAAGAGTCAGCG
    AAACGTGCATTAGCTTCATATAGTAACTTGAATAATGCGCAATCAACTGCAGCAACTAGT
    CAAATTGACAATGCAACGACAGTAGCAGGCGTAACTGCTGCACAAAATACTGCTAATGAA
    TTAAATACAGCAATGGGTCAACTTCAAAATGGTATAAATGACCAAAACACTGTTAAACAA
    CAAGTGAACTTTACAGATGCTGACCAAGGTAAGAAAGATGCTTACACAAATGCTGTTACG
    AATGCTCAAGGTATTTTAGATAAAGCACACGGTCAAAATATGACGAAAGCACAAGTTGAA
    GCTGCATTAAATCAAGTAACGACTGCTAAGAATGCTTTAAACGGTGACGCAAATGTAAGA
    CAAGCAAAATCAGATGCGAAAGCAAACTTAGGTACATTAACACACTTAAATAATGCACAA
    AAACAAGATTTAACATCACAAATCGAAGGCGCAACAACAGTCAACGGTGTAAATGGTGTT
    AAAACGAAAGCACAAGACTTAGATGGTGCAATGCAACGATTACAATCAGCTATAGCAAAT
    AAAGATCAAACTAAAGCGAGCGAAAATTACATCGACGCAGATCCAACTAAGAAAACAGCA
    TTTGATAATGCTATCACACAAGCTGAATCTTACTTAAATAAAGATCACGGTGCGAATAAA
    GATAAGCAAGCTGTTGAACAAGCAATTCAAAGTGTAACGTCTACTGAAAATGCTTTGAAC
    GGTGACGCGAACTTACAACGCGCTAAAACTGAAGCTATACAAGCTATCGATAACTTGACA
    CATTTGAATACACCACAAAAAACAGCATTAAAACAACAAGTGAACGCTGCGCAACGTGTA
    TCAGGTGTAACTGATCTGAAAAATAGTGCTACATCACTTAATAATGCGATGGATCAATTA
    AAACAAGCAATTGCTGATCATGACACAATTGTAGCTAGTGGTAATTACACTAACGCGAGT
    CCTGATAAGCAAGGTGCTTATACTGATGCATATAATGCTGCGAAAAACATTGTAAATGGT
    TCGCCTAATGTGATTACAAATGCAGCAGATGTTACAGCAGCAACACAACGTGTTAATAAT
    GCTGAAACAGGTTTAAACGGTGATACAAACTTAGCAACTGCGAAGCAACAAGCTAAAGAT
    GCATTACGTCAAATGACACATTTATCTGATGCACAAAAACAAAGTATTACTGGTCAAATT
    GATAGCGCGACACAAGTAACTGGCGTTCAAAGTGTGAAAGACAACGCGACAAATCTTGAT
    AATGCAATGAATCAACTTCGAAATAGTATTGCGAATAAAGATGATGTAAAAGCGAGTCAA
    CCATATGTTGATGCAGATAGAGATAAACAAAATGCATACAATACAGCAGTTACAAATGCT
    GAAAATATCATTAATGCAACGAGTCAGCCGACACTTGATCCATCTGCAGTAACACAAGCA
    GCTAATCAAGTGAGCACTAACAAAACTGCGCTTAATGGTGCACAAAACTTAGCGAATAAA
    AAGCAAGAAACGACTGCTAACATCAACCAATTAAGTCATTTAAATAATGCTCAAAAGCAA
    GATTTAAATACGCAAGTGACAAATGCACCAAATATTAGCACAGTAAATCAAGTGAAAACT
    AAAGCTGAACAATTAGATCAAGCAATGGAACGTTTAATCAACGGAATCCAAGACAAAGAT
    CAAGTGAAACAAAGTGTTAACTTTACAGATGCAGATCCAGAAAAACAAACAGCATACAAC
    AATGCGGTAACTGCTGCTGAAAATATTATTAATCAAGCAAATGGTACAAATGCGAACCAA
    TCACAAGTTGAAGCAGCACTTTCAACTGTAACAACTACGAAACAAGCGTTGAATGGTGAT
    AGAAAAGTAACAGATGCTAAAAACAATGCAAACCAAACATTATCTACGTTAGATAACTTA
    AACAATGCACAAAAAGGTGCTGTTACTGGAAACATCAATCAAGCGCACACTGTAGCTGAA
    GTAACGCAAGCCATTCAAACCGCTCAGGAACTGAATACAGCGATGGGTAACTTGAAAAAT
    AGCTTGAATGATAAAGACACTACACTTGGCAGTCAAAACTTTGCAGATGCAGATCCAGAG
    AAGAAAAATGCATACAATGAAGCGGTTCATAATGCTGAAAATATTTTAAATAAATCTACA
    GGTACGAACGTGCCTAAAGATCAAGTTGAAGCAGCTATGAATCAAGTGAATGCTACAAAA
    GCAGCGCTTAATGGTACTCAAAACCTTGAAAAAGCTAAACAACACGCAAATACAGCAATT
    GACGGTTTAAGCCATTTAACAAATGCACAAAAAGAGGCATTAAAACAATTGGTACAACAA
    TCGACTACTGTTGCAGAAGCACAAGGTAATGAGCAAAAAGCAAACAATGTTGATGCAGCA
    ATGGACAAATTACGTCAAAGTATTGCAGATAATGCGACAACAAAACAAAACCAAAATTAT
    ACTGATGCAAGTCAGAATAAAAAGGATGCGTACAATAATGCTGTCACAACTGCACAAGGT
    ATTATTGATCAAACTACAAGTCCAACTTTAGATCCGACTGTTATCAATCAAGCTGCTGGA
    CAAGTAAGCACAACTAAAAATGCATTAAATGGTAATGAAAACCTAGAGGCAGCGAAACAA
    CAAGCGTCACAATCATTAGGTTCATTAGATAACTTAAATAATGCGCAAAAACAAACAGTT
    ACTGATCAAATTAATGGCGCGCATACTGTTGATGAAGCAAATCAAATTAAGCAAAATGCG
    CAAAACTTAAATACAGCGATGGGTAACTTGAAACAAGCGATAGCTGACAAAGATGCTACG
    AAAGCGACAGTTAACTTCACTGATGCAGATCAAGCAAAACAACAAGCATATAACACTGCT
    GTTACAAATGCTGAAAATATCATTTCAAAAGCTAATGGCGGCAATGCAACACAAGCTGAA
    GTTGAACAAGCAATCAAACAAGTTAATGCTGCAAAACAAGCATTAAATGGTAATGCCAAC
    GTTCAACATGCAAAAGACGAAGCAACAGCATTAATTAATAGCTCTAATGACCTTAACCAA
    GCACAAAAAGACGCATTAAAACAACAAGTTCAAAATGCAACTACTGTAGCTGGTGTAAAC
    AATGTTAAACAAACAGCACAAGAGTTAAACAATGCTATGACACAATTAAAACAAGGCATT
    GCAGATAAAGAACAAACAAAAGCTGATGGTAACTTTGTCAATGCAGATCCTGATAAGCAA
    AATGCATATAATCAAGCAGTAGCGAAAGCTGAAGCATTAATTAGTGCTACGCCTGATGTT
    GTCGTTACACCTAGCGAAATTACTGCAGCGTTAAATAAAGTTACGCAAGCTAAAAATGAT
    TTAAATGGTAATACAAACTTAGCAACGGCGAAACAAAATGTTCAACATGCTATTGATCAA
    TTGCCAAACTTAAACCAAGCGCAACGTGATGAATACAGCAAACAAATCACGCAAGCAACA
    CTTGTACCAAACGTCAATGCTATTCAACAAGCGGCGACAACGCTTAATGACGCGATGACA
    CAATTGAAACAAGGTATTGCGAATAAAGCACAAATTAAAGGTAGCGAGAACTATCACGAT
    GCTGATACTGACAAGCAAACAGCATATGATAATGCAGTAACAAAAGCAGAAGAATTGTTA
    AAACAAACAACAAATCCAACAATGGATCCAAATACAATTCAACAAGCATTAACTAAAGTG
    AATGACACAAATCAAGCACTTAACGGTAATCAAAAATTAGCTGATGCCAAACAAGATGCT
    AAGACAACACTTGGTACACTAGATCATTTAAATGATGCTCAAAAACAAGCGCTAACAACT
    CAAGTTGAACAAGCACCAGATATTGCAACAGTTAATAATGTTAAGCAAAATGCTCAAAAT
    CTGAATAATGCTATGACTAACTTAAACAATGCATTACAAGATAAAACTGAGACATTAAAT
    AGCATTAACTTTACTGATGCAGATCAAGCTAAGAAAGATGCTTATACTAATGCGGTTTCA
    CATGCAGAAGGTATTTTATCTAAAGCAAATGGCAGCAATGCAAGTCAAACTGAAGTGGAA
    CAAGCGATGCAACGTGTGAACGAAGCGAAACAAGCATTGAATGGTAATGACAATGTACAA
    CGTGCAAAAGATGCAGCGAAACAAGTGATTACAAATGCAAATGATTTAAATCAAGCGCAA
    AAAGATGCATTAAAACAACAAGTCGATGCTGCGCAAACTGTTGCAAATGTAAACACGATT
    AAGCAAACAGCACAAGATTTAAATCAAGCAATGACACAATTGAAACAAGGTATTGCAGAT
    AAAGACCAAACTAAAGCAAATGGTAACTTTGTCAATGCTGATACTGATAAGCAAAATGCT
    TACAACAATGCGGTAGCACATGCTGAACAAATAATTAGTGGTACACCAAATGCAAACGTG
    GATCCACAACAAGTGGCTCAAGCGTTACAACAAGTGAATCAAGCTAAGGGTGATTTAAAC
    GGTAACCATAACTTACAAGTTGCTAAAGACAATGCAAATACAGCCATTGATCAGTTACCA
    AACTTAAATCAACCACAAAAAACAGCATTAAAAGACCAAGTGTCGCATGCAGAACTTGTT
    ACAGGTGTTAATGCTATTAAGCAAAATGCTGATGCGTTAAATAATGCAATGGGTACATTG
    AAACAACAAATTCAAGCGAACAGTCAAGTACCACAGTCAGTTGACTTTACACAAGCGGAT
    CAAGACAAACAACAAGCATATAACAATGCGGCTAACCAAGCGCAACAAATCGCAAATGGC
    ATACCAACACCTGTATTGACGCCTGATACAGTAACACAAGCAGTGACAACTATGAATCAA
    GCGAAAGATGCATTAAACGGTGATGAAAAATTAGCACAAGCGAAACAAGAAGCTTTAGCA
    AATCTTGATACGTTACGCGATTTAAATCAACCACAACGTGATGCATTACGTAACCAAATC
    AATCAAGCACAAGCGTTAGCTACAGTTGAACAAACTAAACAAAATGCACAAAATGTGAAT
    ACAGCAATGAGTAACTTGAAACAAGGTATTGCAAACAAAGATACTGTCAAAGCAAGTGAG
    AACTATCATGATGCTGATGCCGATAAGCAAACAGCATATACAAATGCAGTGTCTCAAGCG
    GAAGGTATTATCAATCAAACGACAAATCCAACGCTTAACCCAGATGAAATAACACGTGCA
    TTAACTCAAGTGACTGATGCTAAAAATGGCTTAAACGGTGAAGCTAAATTGGCAACTGAA
    AAGCAAAATGCTAAAGATGCCGTAAGTGGGATGACGCATTTAAACGATGCTCAAAAACAA
    GCATTAAAAGGTCAAATCGATCAATCGCCTGAAATTGCTACAGTGAACCAAGTTAAACAA
    ACAGCAACGAGCCTAGATCAAGCAATGGATCAATTATCACAAGCTATTAATGATAAAGCT
    CAAACATTAGCGGACGGTAATTACTTAAATGCAGATCCTGACAAACAAAATGCGTATAAA
    CAGGCAGTAGCAAAAGCTGAAGCATTATTGAATAAACAAAGTGGTACTAATGAAGTACAA
    GCACAAGTTGAAAGCATCACTAATGAAGTGAACGCAGCGAAACAAGCATTAAATGGTAAT
    GACAATTTGGCAAATGCAAAACAACAAGCAAAACAACAATTGGCGAACTTAACACACTTA
    AATGATGCACAAAAACAATCATTTGAAAGTCAAATTACACAAGCGCCACTTGTTACAGAT
    GTCACTACGATTAATCAAAAAGCACAAACGTTAGATCATGCGATGGAATTATTAAGAAAT
    AGTGTTGCGGATAATCAAACGACATTAGCGTCTGAAGATTATCATGATGCAACTGCGCAA
    AGACAAAATGACTATAACCAAGCTGTAACAGCTGCTAATAATATCATTAATCAAACTACA
    TCGCCTACGATGAATCCAGATGATGTTAATGGTGCAACGACACAAGTGAATAATACGAAA
    GTTGCATTAGATGGTGATGAAAACCTTGCAGCAGCTAAACAACAAGCAAACAACAGACTT
    GATCAATTAGATCATTTGAATAATGCGCAAAAGCAACAGTTACAATCACAAATTACGCAA
    TCATCTGATATTGCTGCAGTTAATGGTCACAAACAAACAGCAGAATCTTTAAATACTGCG
    ATGGGTAACTTAATTAATGCGATTGCAGATCATCAAGCCGTTGAACAACGTGGTAACTTC
    ATCAATGCTGATACTGATAAACAAACTGCTTATAATACAGCGGTAAATGAAGCAGCAGCA
    ATGATTAACAAACAAACTGGTCAAAATGCGAACCAAACAGAAGTAGAACAAGCTATTACT
    AAAGTTCAAACAACACTTCAAGCGTTAAATGGAGACCATAATTTACAAGTTGCTAAAACA
    AATGCGACGCAAGCAATTGATGCTTTAACAAGCTTAAATGATCCTCAAAAAACAGCATTA
    AAAGACCAAGTTACAGCTGCAACTTTAGTAACTGCAGTTCATCAAATTGAACAAAATGCG
    AATACGCTTAACCAAGCAATGCATGGTTTAAGACAGAGCATTCAAGATAACGCAGCAACT
    AAAGCAAATAGCAAATATATCAACGAAGATCAACCAGAGCAACAAAACTATGATCAAGCT
    GTTCAAGCCGCAAATAATATTATCAATGAACAAACTGCAACATTAGATAATAATGCGATT
    AATCAAGCAGCGACAACTGTGAATACAACGAAAGCAGCATTACATGGTGATGTGAAGTTA
    CAAAATGATAAAGATCATGCTAAGCAAACGGTTAGTCAATTAGCACATCTAAACAATGCA
    CAAAAACATATGGAAGATACGTTAATTGATAGTGAAACAACTAGAACAGCAGTTAAGCAA
    GATTTGACTGAAGCACAAGCATTAGATCAACTTATGGATGCATTACAACAAAGTATTGCT
    GACAAAGATGCAACACGTGCGAGCAGTGCATATGTCAATGCAGAACCGAATAAAAAACAA
    TCCTATGATGAAGCAGTTCAAAATGCTGAGTCTATCATTGCAGGATTAAATAATCCAACT
    ATCAATAAAGGTAATGTATCAAGTGCGACTCAAGCAGTAATATCATCTAAAAATGCATTA
    GATGGTGTTGAACGATTAGCTCAAGATAAGCAAACTGCTGGAAATTCTCTAAATCATTTA
    GATCAATTAACACCAGCTCAACAACAAGCGCTAGAAAATCAAATTAATAATGCAACAACT
    CGTGGCGAAGTAGCACAAAAATTAACTGAAGCACAAGCACTTAACCAAGCAATGGAAGCT
    TTACGTAATAGCATTCAAGATCAACAGCAAACGGAAGCGGGTAGCAAGTTTATCAATGAA
    GATAAACCACAAAAAGATGCTTACCAAGCAGCAGTTCAAAATGCAAAAGATTTAATTAAT
    CAAACTAACAATCCAACGCTTGATAAAGCACAAGTTGAACAATTGACACAAGCTGTTAAC
    CAAGCTAAAGATAACCTACACGGTGATCAAAAACTTGCAGACGATAAACAACATGCGGTT
    ACTGATTTAAATCAATTAAATGGTTTGAATAATCCGCAACGTCAAGCACTTGAAAGCCAA
    ATAAACAACGCAGCAACTCGTGGCGAAGTAGCACAAAAATTAGCTGAAGCAAAAGCGCTT
    GATCAAGCAATGCAAGCATTACGTAATAGTATTCAAGATCAACAACAAACAGAATCTGGT
    AGCAAGTTTATCAATGAAGATAAACCGCAAAAAGATGCTTACCAAGCAGCAGTTCAAAAT
    GCAAAAGATTTAATTAACCAAACAGGTAATCCAACACTCGACAAATCACAAGTAGAACAA
    TTGACACAAGCAGTAACAACTGCAAAAGATAATCTACATGGTGATCAAAAACTTGCTCGT
    GATCAACAACAAGCAGTAACAACTGTAAATGCATTGCCAAACTTAAATCATGCACAACAA
    CAAGCATTAACTGATGCTATAAATGCAGCGCCTACAAGAACAGAGGTTGCACAACATGTT
    CAAACTGCTACTGAACTTGATCACGCGATGGAAACATTGAAAAATAAAGTTGATCAAGTG
    AATACAGATAAGGCTCAACCAAATTACACTGAAGCGTCAACTGATAAAAAAGAAGCAGTA
    GATCAAGCGTTACAAGCTGCAGAAAGCATTACAGATCCAACTAATGGTTCAAATGCGAAT
    AAAGACGCTGTAGACCAAGTATTAACTAAGCTTCAAGAAAAAGAAAATGAGTTAAATGGT
    AATGAGAGAGTCGCTGAAGCTAAAACACAAGCGAAACAAACTATTGACCAATTAACACAT
    TTAAATGCTGATCAAATTGCAACTGCTAAACAAAACATTGATCAAGCGACGAAACTTCAA
    CCAATTGCTGAATTAGTAGATCAAGCAACGCAATTGAATCAATCTATGGATCAATTACAA
    CAAGCAGTTAATGAACATGCTAACGTTGAGCAAACTGTAGATTACACACAAGCAGATTCA
    GATAAACAAAATGCTTATAAACAAGCTATTGCTGATGCTGAAAATGTATTGAAACAAAAT
    GCGAATAAGCAACAAGTGGATCAAGCACTTCAAAATATTTTAAATGCAAAACAAGCATTA
    AATGGTGATGAACGTGTAGCACTTGCTAAAACAAATGGTAAACATGACATCGACCAATTG
    AATGCATTAAACAATGCTCAACAAGATGGATTTAAAGGTCGCATCGATCAATCAAACGAT
    TTAAATCAAATCCAACAAATTGTAGATGAGGCTAAGGCACTTAATCGTGCAATGGATCAA
    TTGTCACAAGAAATCACTGACAATGAAGGACGCACGAAAGGTAGCACGAACTATGTCAAT
    GCAGATACACAAGTCAAACAAGTATATGATGAAACGGTTGATAAAGCGAAACAAGCACTT
    GATAAATCGACTGGTCAAAACTTAACTGCAAAACAAGTTATCAAATTAAATGATGCAGTC
    ACTGCAGCTAAGAAAGCATTAAATGGTGAAGAAAGACTTAATAATCGTAAAGCTGAAGCA
    TTACAAAGATTGGATCAATTAACACATCTAAACAATGCTCAAAGACAATTAGCAATCCAA
    CAAATTAATAATGCTGAAACGCTAAATAAAGCATCTCGAGCAATTAATAGAGCAACTAAA
    TTAGATAATGCAATGGGTGCAGTACAACAATATATTGACGAACAGCACCTTGGTGTTATC
    AGCAGCACAAATTACATCAATGCAGATGACAATTTGAAAGCAAATTATGATAATGCAATT
    GCGAATGCAGCACATGAGTTAGATAAAGTGCAAGGTAATGCAATTGCAAAAGCTGAAGCA
    GAGCAATTGAAACAAAATATTATCGATGCTCAAAATGCATTAAATGGAGACCAAAACCTT
    GCAAATGCCAAAGATAAAGCAAATGCGTTTGTTAATTCGTTAAATGGATTAAATCAACAG
    CAACAAGATCTTGCACATAAAGCAATTAACAATGCCGATACTGTATCAGATGTAACAGAT
    ATTGTTAATAATCAAATTGACTTAAATGATGCAATGGAAACATTGAAACATTTAGTTGAC
    AATGAAATTCCAAATGCAGAGCAAACTGTCAATTACCAAAACGCTGACGATAATGCTAAA
    ACAAACTTCGATGATGCCAAACGTCTAGCAAATACATTGCTAAATAGTGATAACACAAAT
    GTGAATGATATCAATGGCGCAATCCAAGCAGTCAATGATGCAATCCATAATCTTAATGGT
    GATCAACGACTACAAGATGCTAAAGACAAGGCAATTCAATCTATTAATCAAGCTTTAGCT
    AATAAGCTAAAAGAAATCGAAGCTTCAAATGCGACGGATCAAGACAAGCTTATTGCGAAA
    AATAAAGCAGAAGAATTGGCAAACAGCATCATCAACAACATTAATAAAGCAACAAGTAAT
    CAGGCTGTATCTCAAGTTCAAACAGCAGGCAACCACGCGATTGAACAAGTGCATGCCAAT
    GAAATACCAAAAGCAAAAATTGATGCCAATAAAGACGTTGATAAGCAAGTTCAAGCATTA
    ATTGACGAAATTGATCGAAATCCAAATCTAACAGATAAGGAAAAACAAGCACTTAAAGAT
    CGTATTAATCAAATACTTCAACAAGGTCATAACGGCATTAACAATGCGATGACTAAAGAA
    GAAATTGAACAAGCCAAAGCACAACTTGCGCAAGCATTACAAGACATCAAAGATTTAGTG
    AAAGCTAAAGAAGATGCGAAACAAGATGTTGATAAACAAGTTCAAGCTTTAATTGACGAA
    ATCGATCAAAATCCAAATCTAACAGATAAGGAAAAACAAGCACTTAAAGATCGTATTAAT
    CAAATACTTCAACAAGGTCATAACGACATTAACAATGCGATGACAAAAGAAGCAATTGAA
    CAAGCAAAAGAACGTTTAGCGCAAGCATTGCAAGACATCAAAGATTTAGTGAAAGCTAAA
    GAAGATGCGAAAAATGATATTGATAAACGTGTACAAGCTTTAATTGACGAAATCGATCAA
    AATCCAAATCTAACAGATAAGGAAAAACAAGCACTTAAAGATCGAATTAATCAAATACTT
    CAACAAGGTCATAACGACATTAACAATGCGCTGACTAAAGAAGAAATTGAGCAGGCAAAA
    GCACAACTTGCACAAGCATTGCAAGACATCAAAGATTTAGTGAAAGCTAAAGAAGATGCG
    AAAAATGCAATAAAAGCCTTAGCTAATGCGAAGCGTGATCAAATCAATTCAAATCCAGAT
    TTAACACCTGAGCAAAAAGCAAAAGCGCTCAAAGAAATTGACGAAGCTGAAAAACGAGCA
    CTACAAAACGTTGAGAATGCTCAAACTATAGATCAATTAAATCGAGGATTAAACTTAGGT
    TTAGATGACATTAGAAATACACATGTATGGGAGGTTGATGAACAACCTGCTGTAAATGAA
    ATTTTTGAAGCAACACCTGAGCAAATCCTAGTTAATGGTGAACTCATTGTACATCGTGAT
    GACATCATTACAGAACAAGATATTCTTGCACACATAAACTTAATTGATCAGCTTTCAGCA
    GAAGTCATCGATACACCATCAACTGCAACGATTTCTGATAGCTTAACAGCAAAAGTTGAA
    GTTACATTGCTTGATGGATCAAAAGTGATTGTTAATGTTCCTGTAAAAGTTGTAGAAAAA
    GAATTGTCAGTAGTCAAACAACAGGCAATTGAATCAATCGAAAATGCGGCACAACAAAAG
    ATTAATGAAATCAATAATAGTGTGACATTAACACTGGAACAAAAAGAAGCTGCAATTGCA
    GAAGTTAATAAGCTTAAACAACAAGCAATTGATCATGTTAACAATGCACCTGATGTTCAT
    TCAGTTGAAGAAATTCAACAACAAGAACAAGCGCATATTGAACAATTTAATCCAGAACAA
    TTTACGATTGAACAAGCAAAATCAAATGCAATTAAATCGATTGAAGATGCAATTCAACAT
    ATGATTGATGAAATCAAAGCTCGTACTGATCTAACAGATAAAGAGAAGCAAGAAGCTATT
    GCTAAGTTAAATCAATTAAAAGAACAAGCAATTCAAGCGATTCAACGTGCGCAAAGCATC
    GATGAAATAAGTGAGCAATTGGAACAATTTAAAGCTCAAATGAAAGCAGCTAATCCAACA
    GCAAAAGAACTAGCTAAACGCAAGCAAGAAGCTATTAGTAGAATTAAAGACTTTTCAAAT
    GAAAAAATAAATAGTATTCGAAATAGTGAAATTGGCACAGCTGATGAAAAACAAGCAGCA
    ATGAATCAAATTAACGAAATTGTGCTTGAAACAATTAGAGATATTAATAATGCGCATACA
    TTACAGCAAGTTGAGGCTGCATTGAACAATGGTATTGCTCGAATTTCAGCAGTACAAATT
    GTAACATCTGATCGTGCTAAACAATCGTCAAGTACTGGAAATGAATCTAATAGCCATTTA
    ACAATTGGTTATGGAACTGCAAATCATCCATTTAACAGTTCGACTATTGGACATAAAAAG
    AAACTTGATGAAGATGATGACATTGATCCACTTCATATGCGTCACTTTAGTAATAATTTC
    GGTAATGTTATTAAAAACGCTATTGGTGTGGTGGGTATCTCTGGTTTACTAGCTAGTTTC
    TGGTTCTTCATTGCCAAACGTCGTCGTAAAGAAGATGAAGAGGAAGAATTAGAAATAAGA
    GATAATAATAAAGATTCAATAAAAGAGACTTTAGACGATACAAAACATTTACCACTTTTA
    TTTGCGAAACGTCGCAGAAAAGAAGATGAAGAAGATGTTACTGTTGAAGAAAAAGATTCG
    CTAAATAATGGCGAGTCACTCGATAAAGTTAAACATACGCCGTTCTTCTTACCAAAACGT
    CGTCGTAAAGAAGATGAAGAAGATGTGGAAGTTACAAATGAAAACACAGATGAAAAAGTG
    TTGAAAGATAACGAACATTCACCACTCTTATTCGCAAAACGACGCAAAGATAAAGAGGAA
    GATGTTGAAACAACAACTAGTATTGAATCTAAAGATGAGGACGTTCCTTTATTATTGGCT
    AAAAAGAAAAATCAAAAAGATAACCAATCCAAAGACAAAAAGTCAGCATCAAAAAATACT
    TCTAAAAAGGTAGCAGCTAAAAAGAAGAAAAAGAAAGCTAAGAAAAATAAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2880
    2940
    3000
    3060
    3120
    3180
    3240
    3300
    3360
    3420
    3480
    3540
    3600
    3660
    3720
    3780
    3840
    3900
    3960
    4020
    4080
    4140
    4200
    4260
    4320
    4380
    4440
    4500
    4560
    4620
    4680
    4740
    4800
    4860
    4920
    4980
    5040
    5100
    5160
    5220
    5280
    5340
    5400
    5460
    5520
    5580
    5640
    5700
    5760
    5820
    5880
    5940
    6000
    6060
    6120
    6180
    6240
    6300
    6360
    6420
    6480
    6540
    6600
    6660
    6720
    6780
    6840
    6900
    6960
    7020
    7080
    7140
    7200
    7260
    7320
    7380
    7440
    7500
    7560
    7620
    7680
    7740
    7800
    7860
    7920
    7980
    8040
    8100
    8160
    8220
    8280
    8340
    8400
    8460
    8520
    8580
    8640
    8700
    8760
    8820
    8880
    8940
    9000
    9060
    9120
    9180
    9240
    9300
    9360
    9420
    9480
    9540
    9600
    9660
    9720
    9780
    9840
    9900
    9960
    10020
    10080
    10140
    10200
    10260
    10320
    10380
    10440
    10500
    10560
    10620
    10680
    10740
    10800
    10860
    10920
    10980
    11040
    11100
    11160
    11220
    11280
    11340
    11400
    11460
    11520
    11580
    11640
    11700
    11760
    11820
    11880
    11940
    12000
    12060
    12120
    12180
    12240
    12300
    12360
    12420
    12480
    12540
    12600
    12660
    12720
    12780
    12840
    12900
    12960
    13020
    13080
    13140
    13200
    13260
    13320
    13380
    13440
    13500
    13560
    13620
    13680
    13740
    13800
    13860
    13920
    13980
    14040
    14100
    14160
    14220
    14280
    14340
    14400
    14460
    14520
    14580
    14640
    14700
    14760
    14820
    14880
    14940
    15000
    15060
    15120
    15180
    15240
    15300
    15360
    15420
    15480
    15540
    15600
    15660
    15720
    15780
    15840
    15900
    15960
    16020
    16080
    16140
    16200
    16260
    16320
    16380
    16440
    16500
    16560
    16620
    16680
    16740
    16800
    16860
    16920
    16980
    17040
    17100
    17160
    17220
    17280
    17340
    17400
    17460
    17520
    17580
    17640
    17700
    17760
    17820
    17880
    17940
    18000
    18060
    18120
    18180
    18240
    18300
    18360
    18420
    18480
    18540
    18600
    18660
    18720
    18780
    18840
    18900
    18960
    19020
    19080
    19140
    19200
    19260
    19320
    19380
    19440
    19500
    19560
    19620
    19680
    19740
    19800
    19860
    19920
    19980
    20040
    20100
    20160
    20220
    20280
    20340
    20400
    20460
    20520
    20580
    20640
    20700
    20760
    20820
    20880
    20940
    21000
    21060
    21120
    21180
    21240
    21300
    21360
    21420
    21480
    21540
    21600
    21660
    21720
    21780
    21840
    21900
    21960
    22020
    22080
    22140
    22200
    22260
    22320
    22380
    22440
    22500
    22560
    22620
    22680
    22740
    22800
    22860
    22920
    22980
    23040
    23100
    23160
    23220
    23280
    23340
    23400
    23460
    23520
    23580
    23640
    23700
    23760
    23820
    23880
    23940
    24000
    24060
    24120
    24180
    24240
    24300
    24360
    24420
    24480
    24540
    24600
    24660
    24720
    24780
    24840
    24900
    24960
    25020
    25080
    25140
    25200
    25260
    25320
    25380
    25440
    25500
    25560
    25620
    25680
    25740
    25800
    25860
    25920
    25980
    26040
    26100
    26160
    26220
    26280
    26340
    26400
    26460
    26520
    26580
    26640
    26700
    26760
    26820
    26880
    26940
    27000
    27060
    27120
    27180
    27240
    27300
    27360
    27420
    27480
    27540
    27600
    27660
    27720
    27780
    27840
    27900
    27960
    28020
    28080
    28140
    28200
    28260
    28320
    28380
    28440
    28500
    28560
    28620
    28680
    28740
    28800
    28860
    28920
    28980
    29040
    29100
    29160
    29220
    29280
    29340
    29400
    29460
    29520
    29580
    29640
    29700
    29760
    29820
    29880
    29940
    30000
    30060
    30120
    30180
    30240
    30300
    30360
    30420
    30480
    30540
    30600
    30660
    30720
    30780
    30840
    30900
    30960
    31020
    31080
    31140
    31200
    31260
    31320
    31380
    31440
    31497

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1472 [new locus tag: SACOL_RS07510 ]
  • symbol: Ebh
  • description: cell wall associated fibronectin-binding protein
  • length: 10498
  • theoretical pI: 6.13277
  • theoretical MW: 1.13132e+06
  • GRAVY: -0.744018

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    hyperosmolarity resistance protein Ebh (TIGR04264; HMM-score: 3947.8)
    gram-positive signal peptide, YSIRK family (TIGR01168; HMM-score: 36.6)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02168; HMM-score: 19.4)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02168; HMM-score: 19.4)
  • TheSEED:  
    Putative Staphylococcal surface anchored protein 
  • PFAM:
    B_GA (CL0598) GA; GA module (PF01468; HMM-score: 2411.1)
    FIVAR; FIVAR domain (PF07554; HMM-score: 2060.7)
    DUF1542; Domain of Unknown Function (DUF1542) (PF07564; HMM-score: 292.9)
    E-set (CL0159) Rib; Rib/alpha-like repeat (PF08428; HMM-score: 43.9)
    no clan definedYSIRK_signal; YSIRK type signal peptide (PF04650; HMM-score: 34.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 9.39
    • Extracellular Score: 0.61
    • Internal Helix: 1
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: Signal peptide length 40 aa
    • Ymax: 0.817
    • Ymax_pos: 40
    • Cmax: 0.785
    • Cmax_pos: 40
    • Smax: 0.932
    • Smax_pos: 36
    • Smean: 0.695
    • D: 0.769
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNYRDKIQKFSIRKYTVGTFSTVIATLVFLGFNTSQAHAAETNQPASVVKQKQQSNNEQTENRESQVQNSQNSQNGQSLSATHENEQPNISQANLVDQKVAQSSTTNDEQPASQNVNTKKDSATAATTQPDKEQSKHKQNESQSANKNGNDNRAAHVENHEANVVTASDSSDNGNVQHDRNELQAFFDANYHDYRFIDRENADSGTFNYVKGIFDKINTLLGSNDPINNKDLQLAYKELEQAVALIRTMPQRQQTSRRSNRIQTRSVESRAAEPRSVSDYQNANSSYYVENANDGSGYPVGTYINASSKGAPYNLPTTPWNTLKASDSKEIALMTAKQTGDGYQWVIKFNKGHAPHQNMIFWFALPADQVPVGRTDFVTVNSDGTNVQWSHGAGAGANKPLQQMWEYGVNDPHRSHDFKIRNRSGQVIYDWPTVHIYSLEDLSRASDYFSEAGATPATKAFGRQNFEYINGQKPAESPGVPKVYTFIGQGDASYTISFKTQGPTVNKLYYAAGGRALEYNQLFMYSQLYVESTQDHQQRLNGLRQVVNRTYRIGTTKRVEVSQGNVQTKKVLESTNLNIDDFVDDPLSYVKTPSNKVLGFYSNNANTNAFRPGGAQQLNEYQLSQLFTDQKLQEAARTRNPIRLMIGFDYPDAYGNSETLVPVNLTVLPEIQHNIKFFKNDDTQNIAEKPFSKQAGHPVFYVYAGNQGNASVNLGGSVTSIQPLRINLTSNENFTDKDWQITGIPRTLHIENSTNRPNNARERNIELVGNLLPGDYFGTIRFGRKEQLFEIRVKPHTPTITTTAEQLRGTALQKVPVNISGIPLDPSALVYLVAPTNQTTNGGSEADQIPSGYTILATGTPDGVHNTITIRPQDYVVFIPPVGKQIRAVVYYNKVVASNMSNAVTILPDDIPPTINNPVGINAKYYRGDEVNFTMGVSDRHSGIKNTTITTLPNGWTSNLTKADKNNGSLSITGRVSMNQAFNSDITFKVSATDNVNNTTNDSQSKHVSIHVGKISEDAHPIVLGNTEKVVVVNPTAVSNDEKQSIITAFMNKNQNIRGYLASTDPVTVDNNGNVTLHYRDGSSTTLDATNVMTYEPVVKPEYQTVNAAKTATVTIAKGQSFSIGDIKQYFTLSNGQPIPSGTFTNITSDRTIPTAQEVSQMNAGTQLYHITATNAYHKDSEDFYISLKIIDVKQPEGDQRVYRTSTYDLTTDEISKVKQAFINANRDVITLAEGDISVTNTPNGANVSTITVNINKGRLTKSFASNLANMNFLRWVNFPQDYTVTWTNAKIANRPTDGGLSWSDDHKSLIYRYDATLGTQITTNDILTMLKATTTVPGLRNNITGNEKSQAEAGGRPNFRTTGYSQSNATTDGQRQFTLNGQVIQVLDIINPSNGYGGQPVTNSNTRANHSNSTVVNVNEPAANGAGAFTIDHVVKSNSTHNASDAVYKAQLYLTPYGPKQYVEHLNQNTGNTTDAINIYFVPSDLVNPTISVGNYTNHQVFSGETFTNTITANDNFGVQSVTVPNTSQITGTVDNNHQHVSATAPNVTSATNKTINLLATDTSGNTATTSFNVTVKPLRDKYRVGTSSTAANPVRIANISNNATVSQADQTTIINSLTFTETVPNRSYARASANEITSKTVSNVSRTGNNANVTVTVTYQDGTTSTVTVPVKHVIPEIVAHSHYTVQGQDFPAGNGSSASDYFKLSNGSDIADATITWVSGQAPNKDNTRIGEDITVTAHILIDGETTPITKTATYKVVRTVPKHVFETARGVLYPGVSDMYDAKQYVKPVNNSWSTNAQHMNFQFVGTYGPNKDVVGISTRLIRVTYDNRQTEDLTILSKVKPDPPRIDANSVTYKAGLTNQEIKVNNVLNNSSVKLFKADNTPLNVTNITHGSGFSSVVTVSDALPNGGIKAKSSISMNNVTYTTQDEHGQVVTVTRNESVDSNDSATVTVTPQLQATTEGAVFIKGGDGFDFGHVERFIQNPPHGATVAWHDSPDTWKNTVGNTHKTAVVTLPNGQGTRNVEVPVKVYPVANAKAPSRDVKGQNLTNGTDAMNYITFDPNTNTNGITAAWANRQQPNNQQAGVQHLNVDVTYPGISAAKRVPVTVNVYQFEFPQTTYTTTVGGTLASGTQASGYAHMQNATGLPTDGFTYKWNRDTTGTNDANWSAMNKPNVAKVVNAKYDVIYNGHTFATSLPAKFVVKDVQPAKPTVTETAAGAITIAPGANQTVNTHAGNVTTYADKLVIKRNGNVVTTFTRRNNTSPWVKEASAATVAGIAGTNNGITVAAGTFNPADTIQVVATQGSGETVSDEQRSDDFTVVAPQPNQATTKIWQNGHIDITPNNPSGHLINPTQAMDIAYTEKVGNGAEHSKTINVVRGQNNQWTIANKPDYVTLDAQTGKVTFNANTIKPNSSITITPKAGTGHSVSSNPSTLTAPAAHTVNTTEIVKDYGSNVTAAEINNAVQVANKRTATIKNGTAMPTNLAGGSTTTIPVTVTYNDGSTEEVQESIFTKADKRELITAKNHLDDPVSTEGKKPGTITQYNNAMHNAQQQINTAKTEAQQVINNERATPQQVSDALTKVRAAQTKIDQAKALLQNKEDNSQLVTSKNNLQSSVNQVPSTAGMTQQSIDNYNAKKREAETEITAAQRVIDNGDATAQQISDEKHRVDNALTALNQAKHDLTADTHALEQAVQQLNRTGTTTGKKPASITAYNNSIRALQSDLTSAKNSANAIIQKPIRTVQEVQSALTNVNRVNERLTQAINQLVPLADNSALKTAKTKLDEEINKSVTTDGMTQSSIQAYENAKRAGQTESTNAQNVINNGDATDQQIAAEKTKVEEKYNSLKQAIAGLTPDLAPLQTAKTQLQNDIDQPTSTTGMTSASIAAFNEKLSAARTKIQEIDRVLASHPDVATIRQNVTAANAAKSALDQARNGLTVDKAPLENAKNQLQYSIDTQTSTTGMTQDSINAYNAKLTAARNKIQQINQVLAGSPTVEQINTNTSTANQAKSDLDHARQALTPDKAPLQTAKTQLEQSINQPTDTTGMTTASLNAYNQKLQAARQKLTEINQVLNGNPTVQNINDKVTEANQAKDQLNTARQGLTLDRQPALTTLHGASNLNQAQQNNFTQQINAAQNHAALETIKSNITALNTAMTKLKDSVADNNTIKSDQNYTDATPANKQAYDNAVNAAKGVIGETTNPTMDVNTVNQKAASVKSTKDALDGQQNLQRAKTEATNAITHASDLNQAQKNALTQQVNSAQNVQAVNDIKQTTQSLNTAMTGLKRGVANHNQVVQSDNYVNADTNKKNDYNNAYNHANDIINGNAQHPVITPSDVNNALSNVTSKEHALNGEAKLNAAKQEANTALGHLNNLNNAQRQNLQSQINGAHQIDAVNTIKQNATNLNSAMGNLRQAVADKDQVKRTEDYADADTAKQNAYNSAVSSAETIINQTTNPTMSVDDVNRATSAVTSNKNALNGYEKLAQSKTDAARAIDALPHLNNAQKADVKSKINAASNIAGVNTVKQQGTDLNTAMGNLQGAINDEQTTLNSQNYQDATPSKKTAYTNAVQAAKDILNKSNGQNKTKDQVTEAMNQVNSAKNNLDGTRLLDQAKQTAKQQLNNMTHLTTAQKTNLTNQINSGTTVAGVQTVQSNANTLDQAMNTLRQSIANKDATKASEDYVDANNDKQTAYNNAVAAAETIINANSNPEMNPSTITQKAEQVNSSKTALNGDENLAAAKQNAKTYLNTLTSITDAQKNNLISQITSATRVSGVDTVKQNAQHLDQAMASLQNGINNESQVKSSEKYRDADTNKQQEYDNAITAAKAILNKSTGPNTAQNAVEAALQRVNNAKDALNGDAKLIAAQNAAKQHLGTLTHITTAQRNDLTNQISQATNLAGVESVKQNANSLDGAMGNLQTAINDKSGTLASQNFLDADEQKRNAYNQAVSAAETILNKQTGPNTAKTAVEQALNNVNNAKHALNGTQNLNNAKQAAITAINGASDLNQKQKDALKAQANGAQRVSNAQDVQHNATELNTAMGTLKHAIADKTNTLASSKYVNADSTKQNAYTTKVTNAEHIISGTPTVVTTPSEVTAAANQVNSAKQELNGDERLREAKQNANTAIDALTQLNTPQKAKLKEQVGQANRLEDVQTVQTNGQALNNAMKGLRDSIANETTVKTSQNYTDASPNNQSTYNSAVSNAKGIINQTNNPTMDTSAITQATTQVNNAKNGLNGAENLRNAQNTAKQNLNTLSHLTNNQKSAISSQIDRAGHVSEVTATKNAATELNTQMGNLEQAIHDQNTVKQSVKFTDADKAKRDAYTNAVSRAEAILNKTQGANTSKQDVEAAIQNVSSAKNALNGDQNVTNAKNAAKNALNNLTSINNAQKRDLTTKIDQATTVAGVEAVSNTSTQLNTAMANLQNGINDKTNTLASENYHDADSDKKTAYTQAVTNAENILNKNSGSNLDKTAVENALSQVANAKGALNGNHNLEQAKSNANTTINGLQHLTTAQKDKLKQQVQQAQNVAGVDTVKSSANTLNGAMGTLRNSIQDNTATKNGQNYLDATERNKTNYNNAVDSANGVINATSNPNMDANAINQIATQVTSTKNALDGTHNLTQAKQTATNAIDGATNLNKAQKDALKAQVTSAQRVANVTSIQQTANELNTAMGQLQHGIDDENATKQTQKYRDAEQSKKTAYDQAVAAAKAILNKQTGSNSDKAAVDRALQQVTSTKDALNGDAKLAEAKAAAKQNLGTLNHITNAQRTDLEGQNNQATTVDGVNTVKTNANTLDGAMNSLQGSINDKDATLRNQNYLDADESKRNAYTQAVTAAEGILNKQTGGNTSKADVDNALNAVTRAKAALNGADNLRNAKTSATNTIDGLPNLTQLQKDNLKHQVEQAQNVAGVNGVKDKGNTLNTAMGALRTSIQNDNTTKTSQNYLDASDSNKNNYNTAVNNANGVINATNNPNMDANAINGMANQVNTTKAALNGAQNLAQAKTNATNTINNAHDLNQKQKDALKTQVNNAQRVSDANNVQHTATELNSAMTALKAAIADKERTKASGNYVNADQEKRQAYDSKVTNAENIISGTPNATLTVNDVNSAASQVNAAKTALNGDNNLRVAKEHANNTIDGLAQLNNAQKAKLKEQVQSATTLDGVQTVKNSSQTLNTAMKGLRDSIANEATIKAGQNYTDASPNNRNEYDSAVTAAKAIINQTSNPTMEPNTITQVTSQVTTKEQALNGARNLAQAKTTAKNNLNNLTSINNAQKDALTRSIDGATTVAGVNQETAKATELNNAMHSLQNGINDETQTKQTQKYLDAEPSKKSAYDQAVNAAKAILTKASGQNVDKAAVEQALQNVNSTKTALNGDAKLNEAKAAAKQTLGTLTHINNAQRTALDNEITQATNVEGVNTVKAKAQQLDGAMGQLETSIRDKDTTLQSQNYQDADDAKRTAYSQAVNAAATILNKTAGGNTPKADVERAMQAVTQANTALNGIQNLDRAKQAANTAITNASDLNTKQKEALKAQVTSAGRVSAANGVEHTATELNTAMTALKRAIADKAETKASGNYVNADANKRQAYDEKVTAAENIVSGTPTPTLTPADVTNAATQVTNAKTQLNGNHNLEVAKQNANTAIDGLTSLNGPQKAKLKEQVGQATTLPNVQTVRDNAQTLNTAMKGLRDSIANEATIKAGQNYTDASQNKQTDYNSAVTAAKAIIGQTTSPSMNAQEINQAKDQVTAKQQALNGQENLRTAQTNAKQHLNGLSDLTDAQKDAVKRQIEGATHVNEVTQAQNNADALNTAMTNLKNGIQDQNTIKQGVNFTDADEAKRNAYTNAVTQAEQILNKAQGPNTSKDGVETALENVQRAKNELNGNQNVANAKTTAKNALNNLTSINNAQKEALKSQIEGATTVAGVNQVSTTASELNTAMSNLQNGINDEAATKAAQKYTDADREKQTAYNDAVTAAKTLLDKTAGSNDNKAAVEQALQRVNTAKTALNGDERLNEAKNTAKQQVATMSHLTDAQKANLTSQIESGTTVAGVQGIQANAGTLDQAMNQLRQSIASKDATKSSEDYQDANADLQNAYNDAVTNAEGIISATNNPEMNPDTINQKASQVNSAKSALNGDEKLAAAKQTAKSDIGRLTDLNNAQRTAANAEVDQAPNLAAVTAAKNKATSLNTAMGNLKHALAEKDNTKRSVNYTDADQPKQQAYDTAVTQAEAITNANGSNANETQVQAALNQLNQAKNDLNGDNKVAQAKESAKRALASYSNLNNAQSTAATSQIDNATTVAGVTAAQNTANELNTAMGQLQNGINDQNTVKQQVNFTDADQGKKDAYTNAVTNAQGILDKAHGQNMTKAQVEAALNQVTTAKNALNGDANVRQAKSDAKANLGTLTHLNNAQKQDLTSQIEGATTVNGVNGVKTKAQDLDGAMQRLQSAIANKDQTKASENYIDADPTKKTAFDNAITQAESYLNKDHGANKDKQAVEQAIQSVTSTENALNGDANLQRAKTEAIQAIDNLTHLNTPQKTALKQQVNAAQRVSGVTDLKNSATSLNNAMDQLKQAIADHDTIVASGNYTNASPDKQGAYTDAYNAAKNIVNGSPNVITNAADVTAATQRVNNAETGLNGDTNLATAKQQAKDALRQMTHLSDAQKQSITGQIDSATQVTGVQSVKDNATNLDNAMNQLRNSIANKDDVKASQPYVDADRDKQNAYNTAVTNAENIINATSQPTLDPSAVTQAANQVSTNKTALNGAQNLANKKQETTANINQLSHLNNAQKQDLNTQVTNAPNISTVNQVKTKAEQLDQAMERLINGIQDKDQVKQSVNFTDADPEKQTAYNNAVTAAENIINQANGTNANQSQVEAALSTVTTTKQALNGDRKVTDAKNNANQTLSTLDNLNNAQKGAVTGNINQAHTVAEVTQAIQTAQELNTAMGNLKNSLNDKDTTLGSQNFADADPEKKNAYNEAVHNAENILNKSTGTNVPKDQVEAAMNQVNATKAALNGTQNLEKAKQHANTAIDGLSHLTNAQKEALKQLVQQSTTVAEAQGNEQKANNVDAAMDKLRQSIADNATTKQNQNYTDASQNKKDAYNNAVTTAQGIIDQTTSPTLDPTVINQAAGQVSTTKNALNGNENLEAAKQQASQSLGSLDNLNNAQKQTVTDQINGAHTVDEANQIKQNAQNLNTAMGNLKQAIADKDATKATVNFTDADQAKQQAYNTAVTNAENIISKANGGNATQAEVEQAIKQVNAAKQALNGNANVQHAKDEATALINSSNDLNQAQKDALKQQVQNATTVAGVNNVKQTAQELNNAMTQLKQGIADKEQTKADGNFVNADPDKQNAYNQAVAKAEALISATPDVVVTPSEITAALNKVTQAKNDLNGNTNLATAKQNVQHAIDQLPNLNQAQRDEYSKQITQATLVPNVNAIQQAATTLNDAMTQLKQGIANKAQIKGSENYHDADTDKQTAYDNAVTKAEELLKQTTNPTMDPNTIQQALTKVNDTNQALNGNQKLADAKQDAKTTLGTLDHLNDAQKQALTTQVEQAPDIATVNNVKQNAQNLNNAMTNLNNALQDKTETLNSINFTDADQAKKDAYTNAVSHAEGILSKANGSNASQTEVEQAMQRVNEAKQALNGNDNVQRAKDAAKQVITNANDLNQAQKDALKQQVDAAQTVANVNTIKQTAQDLNQAMTQLKQGIADKDQTKANGNFVNADTDKQNAYNNAVAHAEQIISGTPNANVDPQQVAQALQQVNQAKGDLNGNHNLQVAKDNANTAIDQLPNLNQPQKTALKDQVSHAELVTGVNAIKQNADALNNAMGTLKQQIQANSQVPQSVDFTQADQDKQQAYNNAANQAQQIANGIPTPVLTPDTVTQAVTTMNQAKDALNGDEKLAQAKQEALANLDTLRDLNQPQRDALRNQINQAQALATVEQTKQNAQNVNTAMSNLKQGIANKDTVKASENYHDADADKQTAYTNAVSQAEGIINQTTNPTLNPDEITRALTQVTDAKNGLNGEAKLATEKQNAKDAVSGMTHLNDAQKQALKGQIDQSPEIATVNQVKQTATSLDQAMDQLSQAINDKAQTLADGNYLNADPDKQNAYKQAVAKAEALLNKQSGTNEVQAQVESITNEVNAAKQALNGNDNLANAKQQAKQQLANLTHLNDAQKQSFESQITQAPLVTDVTTINQKAQTLDHAMELLRNSVADNQTTLASEDYHDATAQRQNDYNQAVTAANNIINQTTSPTMNPDDVNGATTQVNNTKVALDGDENLAAAKQQANNRLDQLDHLNNAQKQQLQSQITQSSDIAAVNGHKQTAESLNTAMGNLINAIADHQAVEQRGNFINADTDKQTAYNTAVNEAAAMINKQTGQNANQTEVEQAITKVQTTLQALNGDHNLQVAKTNATQAIDALTSLNDPQKTALKDQVTAATLVTAVHQIEQNANTLNQAMHGLRQSIQDNAATKANSKYINEDQPEQQNYDQAVQAANNIINEQTATLDNNAINQAATTVNTTKAALHGDVKLQNDKDHAKQTVSQLAHLNNAQKHMEDTLIDSETTRTAVKQDLTEAQALDQLMDALQQSIADKDATRASSAYVNAEPNKKQSYDEAVQNAESIIAGLNNPTINKGNVSSATQAVISSKNALDGVERLAQDKQTAGNSLNHLDQLTPAQQQALENQINNATTRGEVAQKLTEAQALNQAMEALRNSIQDQQQTEAGSKFINEDKPQKDAYQAAVQNAKDLINQTNNPTLDKAQVEQLTQAVNQAKDNLHGDQKLADDKQHAVTDLNQLNGLNNPQRQALESQINNAATRGEVAQKLAEAKALDQAMQALRNSIQDQQQTESGSKFINEDKPQKDAYQAAVQNAKDLINQTGNPTLDKSQVEQLTQAVTTAKDNLHGDQKLARDQQQAVTTVNALPNLNHAQQQALTDAINAAPTRTEVAQHVQTATELDHAMETLKNKVDQVNTDKAQPNYTEASTDKKEAVDQALQAAESITDPTNGSNANKDAVDQVLTKLQEKENELNGNERVAEAKTQAKQTIDQLTHLNADQIATAKQNIDQATKLQPIAELVDQATQLNQSMDQLQQAVNEHANVEQTVDYTQADSDKQNAYKQAIADAENVLKQNANKQQVDQALQNILNAKQALNGDERVALAKTNGKHDIDQLNALNNAQQDGFKGRIDQSNDLNQIQQIVDEAKALNRAMDQLSQEITDNEGRTKGSTNYVNADTQVKQVYDETVDKAKQALDKSTGQNLTAKQVIKLNDAVTAAKKALNGEERLNNRKAEALQRLDQLTHLNNAQRQLAIQQINNAETLNKASRAINRATKLDNAMGAVQQYIDEQHLGVISSTNYINADDNLKANYDNAIANAAHELDKVQGNAIAKAEAEQLKQNIIDAQNALNGDQNLANAKDKANAFVNSLNGLNQQQQDLAHKAINNADTVSDVTDIVNNQIDLNDAMETLKHLVDNEIPNAEQTVNYQNADDNAKTNFDDAKRLANTLLNSDNTNVNDINGAIQAVNDAIHNLNGDQRLQDAKDKAIQSINQALANKLKEIEASNATDQDKLIAKNKAEELANSIINNINKATSNQAVSQVQTAGNHAIEQVHANEIPKAKIDANKDVDKQVQALIDEIDRNPNLTDKEKQALKDRINQILQQGHNGINNAMTKEEIEQAKAQLAQALQDIKDLVKAKEDAKQDVDKQVQALIDEIDQNPNLTDKEKQALKDRINQILQQGHNDINNAMTKEAIEQAKERLAQALQDIKDLVKAKEDAKNDIDKRVQALIDEIDQNPNLTDKEKQALKDRINQILQQGHNDINNALTKEEIEQAKAQLAQALQDIKDLVKAKEDAKNAIKALANAKRDQINSNPDLTPEQKAKALKEIDEAEKRALQNVENAQTIDQLNRGLNLGLDDIRNTHVWEVDEQPAVNEIFEATPEQILVNGELIVHRDDIITEQDILAHINLIDQLSAEVIDTPSTATISDSLTAKVEVTLLDGSKVIVNVPVKVVEKELSVVKQQAIESIENAAQQKINEINNSVTLTLEQKEAAIAEVNKLKQQAIDHVNNAPDVHSVEEIQQQEQAHIEQFNPEQFTIEQAKSNAIKSIEDAIQHMIDEIKARTDLTDKEKQEAIAKLNQLKEQAIQAIQRAQSIDEISEQLEQFKAQMKAANPTAKELAKRKQEAISRIKDFSNEKINSIRNSEIGTADEKQAAMNQINEIVLETIRDINNAHTLQQVEAALNNGIARISAVQIVTSDRAKQSSSTGNESNSHLTIGYGTANHPFNSSTIGHKKKLDEDDDIDPLHMRHFSNNFGNVIKNAIGVVGISGLLASFWFFIAKRRRKEDEEEELEIRDNNKDSIKETLDDTKHLPLLFAKRRRKEDEEDVTVEEKDSLNNGESLDKVKHTPFFLPKRRRKEDEEDVEVTNENTDEKVLKDNEHSPLLFAKRRKDKEEDVETTTSIESKDEDVPLLLAKKKNQKDNQSKDKKSASKNTSKKVAAKKKKKKAKKNKK

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cell wall associated [1] [2]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]

Simon R Clarke, Llinos G Harris, R Geoff Richards, Simon J Foster
Analysis of Ebh, a 1.1-megadalton cell wall-associated fibronectin-binding protein of Staphylococcus aureus.
Infect. Immun.: 2002, 70(12);6680-7
[PubMed:12438342] [WorldCat.org] (P p)
Yoshikazu Tanaka, Sou Sakamoto, Makoto Kuroda, Shuichiro Goda, Yong-Gui Gao, Kouhei Tsumoto, Yuzuru Hiragi, Min Yao, Nobuhisa Watanabe, Toshiko Ohta, Isao Tanaka
A helical string of alternately connected three-helix bundles for the cell wall-associated adhesion protein Ebh from Staphylococcus aureus.
Structure: 2008, 16(3);488-96
[PubMed:18334223] [WorldCat.org] [DOI] (P p)