From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1609 [new locus tag: SACOL_RS08205 ]
  • pan locus tag?: SAUPAN004133000
  • symbol: pbp3
  • pan gene symbol?: pbp3
  • synonym:
  • product: penicillin-binding protein 3

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1609 [new locus tag: SACOL_RS08205 ]
  • symbol: pbp3
  • product: penicillin-binding protein 3
  • replicon: chromosome
  • strand: -
  • coordinates: 1638904..1640979
  • length: 2076
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    TTGTTAAAAAGACTAAAAGAAAAATCAAATGATGAAATCGTTCAAAATACAATTAACAAG
    AGAATTAACTTTATATTTGGTGTGATTGTATTTATTTTTGCAGTACTAGTACTACGTTTA
    GGTTATTTACAAATCGCACAAGGCTCACATTATAAACAAATTATAAAAAATGATGAAAAC
    ATTACAGTGAATGAGTCTGTGCCAAGAGGTCGTATTTTAGACAGAAATGGGAAAGTTTTA
    GTTGATAATGCTTCTAAAATGGCTATTACATATACTAGGGGTCGAAAAACAACACAATCG
    GAAATGTTGGATACGGCTGAAAAGTTATCAAAGCTAATCAAGATGGATACTAAGAAAATT
    ACAGAACGTGATAAGAAAGATTTCTGGATTCAGTTGCATCCTAAAAAAGCAAAAGCAATG
    ATGACAAAAGAACAAGCTATGTTAGCAGATGGAAGTATTAAACAAGATCAATATGATAAA
    CAACTGTTATCGAAAATCGGAAAATCACAATTAGATGAATTGTCTTCTAAAGATTTACAA
    GTTTTAGCTATTTTTCGAGAGATGAATGCAGGAACAGTTTTAGATCCACAAATGATAAAA
    AATGAAGATGTCAGTGAAAAAGAGTATGCAGCAGTTTCTCAGCAACTTTCCAAATTACCA
    GGTGTTAACACGTCTATGGATTGGGATAGAAAATATCCATATGGCGATACTTTAAGAGGT
    ATATTCGGAGATGTATCGACACCTGCTGAAGGTATTCCAAAAGAATTGACAGAACATTAC
    TTATCCAAAGGATATTCACGCAATGATCGTGTTGGAAAATCTTACCTAGAATATCAATAT
    GAAGATGTATTGCGTGGTAAGAAGAAAGAAATGAAATACACAACGGACAAATCTGGTAAA
    GTTACATCTTCAGAAGTGTTAAATCCTGGCGCTCGCGGTCAAGATTTGAAATTAACGATC
    GATATAGATCTTCAAAAAGAAGTAGAAGCATTATTAGATAAACAAATTAAGAAGCTTCGC
    AGTCAAGGTGCCAAAGATATGGATAATGCAATGATGGTTGTACAAAATCCTAAAAATGGA
    GACATTCTTGCGCTTGCCGGAAAGCAGATTAATAAGAGTGGTAAAATGACTGATTATGAC
    ATTGGTACGTTTACTTCTCAATTTGCGGTTGGATCTTCTGTAAAAGGTGGAACATTATTA
    GCCGGTTATCAGAATAAAGCTATCAAAGTTGGAGAAACAATGGTCGATGAACCATTACAT
    TTCCAAGGTGGTTTGACAAAACGATCATACTTCAATAAAAACGGGCATGTAACTATTAAT
    GATAAGCAAGCTTTGATGCATTCATCAAACGTATATATGTTTAAAACAGCATTAAAATTA
    GCGGGAGACCCTTATTATTCTGGTATGGCTTTACCTTCAGACATAAGTTCACCTGCCCAA
    AAGCTAAGAAGAGGATTAAATCAAGTAGGCTTAGGTGTGAAAACAGGGATAGATTTACCA
    AATGAAACAAGAGGTCAAATCGAACCATTAACAAATAATCCAGGTAATTATCTAGATTTA
    TCAATTGGTCAATATGATACCTATACACCATTACAATTATCACAATATGTTTCAACTATA
    GCGAATGATGGTTATAGAATACAGCCACACATTGGATTAACGATTCATGAATCAACTAAT
    AAAGATGAGGTTGGTCCACTCAAGAAGAAAATTAATGGCACTGTCTTGAACAAGGTTAAT
    AATACTGAAAAGGAAATCAAACAAATTCAAGAAGGATTCAAAATGGCATTTAATGATAAA
    GATGGTACTGGATATGTTAGTTTTAAAGATACAGTAGTACCTACTGCTGGTAAAACGGGT
    ACCGCAGAAGTGTTCCAAAACGGAGAGCCAAGAGTTAACTCTACTTATATAGGATACGCG
    CCAATTGATGATCCAAAATTAGCGTTTTCAATTGTATATACAAATCAGCCTGTACCACCA
    CCATGGTTAACAGGTGGAGACTTAGGTAGAGATGTAATTAACTACTACTTTAAGCAGTTA
    GGTAAAGATGATAAAAATAAAGACAAAGACAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2076

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1609 [new locus tag: SACOL_RS08205 ]
  • symbol: Pbp3
  • description: penicillin-binding protein 3
  • length: 691
  • theoretical pI: 9.73368
  • theoretical MW: 77237.6
  • GRAVY: -0.603473

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanpenicillin-binding protein 2 (TIGR03423; HMM-score: 277.9)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanstage V sporulation protein D (TIGR02214; HMM-score: 139.8)
    Cellular processesCellular processesSporulation and germinationstage V sporulation protein D (TIGR02214; HMM-score: 139.8)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanpenicillin-binding protein, 1A family (TIGR02074; HMM-score: 46.9)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanpenicillin-binding protein 1C (TIGR02073; HMM-score: 30.6)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanpenicillin-binding protein 1B (TIGR02071; HMM-score: 28.7)
  • TheSEED:  
    Bacterial Cell Division Cell division protein FtsI [Peptidoglycan synthetase] (EC 2.4.1.129) / Transpeptidase, Penicillin binding protein transpeptidase domain 
    Bacterial Cytoskeleton Cell division protein FtsI [Peptidoglycan synthetase] (EC 2.4.1.129) / Transpeptidase, Penicillin binding protein transpeptidase domain 
    Peptidoglycan Biosynthesis Cell division protein FtsI [Peptidoglycan synthetase] (EC 2.4.1.129) / Transpeptidase, Penicillin binding protein transpeptidase domain 
  • PFAM:
    Beta-lactamase (CL0013) Transpeptidase; Penicillin binding protein transpeptidase domain (PF00905; HMM-score: 199.9)
    no clan definedPBP_dimer; Penicillin-binding Protein dimerisation domain (PF03717; HMM-score: 136.2)
    EF_hand (CL0220) EF-hand_6; EF-hand domain (PF13405; HMM-score: 14)
    EF-hand_1; EF hand (PF00036; HMM-score: 11.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1760(ackA)acetate kinase  [1] (data from MRSA252)
    SACOL1385(acnA)aconitate hydratase  [1] (data from MRSA252)
    SACOL0660(adhP)alcohol dehydrogenase  [1] (data from MRSA252)
    SACOL2218(adk)adenylate kinase  [1] (data from MRSA252)
    SACOL0452(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SACOL0154(aldA1)aldehyde dehydrogenase  [1] (data from MRSA252)
    SACOL2657(arcA)arginine deiminase  [1] (data from MRSA252)
    SACOL2656(arcB2)ornithine carbamoyltransferase  [1] (data from MRSA252)
    SACOL0570(clpC)  [1] (data from MRSA252)
    SACOL1272(codY)transcriptional repressor CodY  [1] (data from MRSA252)
    SACOL0557(cysK)cysteine synthase  [1] (data from MRSA252)
    SACOL0123(deoC1)deoxyribose-phosphate aldolase  [1] (data from MRSA252)
    SACOL2130(deoD)purine nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    SACOL0634(eutD)phosphotransacetylase  [1] (data from MRSA252)
    SACOL1245(fabG1)3-oxoacyl-ACP reductase  [1] (data from MRSA252)
    SACOL2117(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SACOL2622(fdaB)fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [1] (data from MRSA252)
    SACOL1072(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1734(gapA2)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SACOL1961(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    SACOL1742(gltA)citrate synthase  [1] (data from MRSA252)
    SACOL0574(gltX)glutamyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL0961(gluD)glutamate dehydrogenase  [1] (data from MRSA252)
    SACOL1622(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL2415(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    SACOL2016(groEL)chaperonin GroEL  [1] (data from MRSA252)
    SACOL0461(guaA)GMP synthase  [1] (data from MRSA252)
    SACOL0460(guaB)inosine-5'-monophosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL0600(ilvE)branched-chain amino acid aminotransferase  [1] (data from MRSA252)
    SACOL1727(infC)translation initiation factor IF-3  [1] (data from MRSA252)
    SACOL0240(ispD)2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase  [1] (data from MRSA252)
    SACOL2618(ldh2)L-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL1808(leuS)leucyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL0562(lysS)lysyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL0533(metS)methionyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SACOL2116(murAB)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SACOL0582(nusG)transcription antitermination protein  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [1] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [1] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL1005(pepF)oligoendopeptidase F  [1] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SACOL0839(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    SACOL1293(pnp)polynucleotide phosphorylase/polyadenylase  [1] (data from MRSA252)
    SACOL1091(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SACOL1092(ptsI)phosphoenolpyruvate-protein phosphotransferase  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL1213(pyrC)dihydroorotase  [1] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [1] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SACOL0583(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL2212(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SACOL2223(rplR)50S ribosomal protein L18  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2228(rplX)50S ribosomal protein L24  [1] (data from MRSA252)
    SACOL0545(rplY)50S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SACOL2221(rpmD)50S ribosomal protein L30  [1] (data from MRSA252)
    SACOL1726(rpmI)50S ribosomal protein L35  [1] (data from MRSA252)
    SACOL2213(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SACOL0588(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SACOL0589(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SACOL1516(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL0592(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    SACOL2225(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL1292(rpsO)30S ribosomal protein S15  [1] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SACOL1642(rpsT)30S ribosomal protein S20  [1] (data from MRSA252)
    SACOL2056(rsbV)anti-anti-sigma factor RsbV  [1] (data from MRSA252)
    SACOL0009(serS)seryl-tRNA synthetase  [1] (data from MRSA252)
    SACOL0095(spa)immunoglobulin G binding protein A precursor  [1] (data from MRSA252)
    SACOL0541(spoVG)regulatory protein SpoVG  [1] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SACOL1262(sucC)succinyl-CoA synthetase subunit beta  [1] (data from MRSA252)
    SACOL1831(tal)translaldolase  [1] (data from MRSA252)
    SACOL1377(tkt)transketolase  [1] (data from MRSA252)
    SACOL0840(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    SACOL1762(tpx)thiol peroxidase  [1] (data from MRSA252)
    SACOL1155(trxA)thioredoxin  [1] (data from MRSA252)
    SACOL1276(tsf)elongation factor Ts  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL0426acetyl-CoA acetyltransferase  [1] (data from MRSA252)
    SACOL0521hypothetical protein  [1] (data from MRSA252)
    SACOL0564pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    SACOL05962-amino-3-ketobutyrate coenzyme A ligase  [1] (data from MRSA252)
    SACOL0688ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SACOL0727hypothetical protein  [1] (data from MRSA252)
    SACOL0875thioredoxin  [1] (data from MRSA252)
    SACOL0876hypothetical protein  [1] (data from MRSA252)
    SACOL0957cyclophilin type peptidyl-prolyl cis-trans isomerase  [1] (data from MRSA252)
    SACOL0973fumarylacetoacetate hydrolase  [1] (data from MRSA252)
    SACOL1020hypothetical protein  [1] (data from MRSA252)
    SACOL1099hypothetical protein  [1] (data from MRSA252)
    SACOL1749NADP-dependent malic enzyme  [1] (data from MRSA252)
    SACOL1801dipeptidase PepV  [1] (data from MRSA252)
    SACOL1802hypothetical protein  [1] (data from MRSA252)
    SACOL1952ferritins family protein  [1] (data from MRSA252)
    SACOL2163hypothetical protein  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)
    SACOL2535D-lactate dehydrogenase  [1] (data from MRSA252)
    SACOL25691-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.17
    • Cytoplasmic Membrane Score: 9.51
    • Cellwall Score: 0.16
    • Extracellular Score: 0.15
    • Internal Helix: 1
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 2
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.192
    • Ymax_pos: 49
    • Cmax: 0.192
    • Cmax_pos: 49
    • Smax: 0.389
    • Smax_pos: 45
    • Smean: 0.124
    • D: 0.166
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLKRLKEKSNDEIVQNTINKRINFIFGVIVFIFAVLVLRLGYLQIAQGSHYKQIIKNDENITVNESVPRGRILDRNGKVLVDNASKMAITYTRGRKTTQSEMLDTAEKLSKLIKMDTKKITERDKKDFWIQLHPKKAKAMMTKEQAMLADGSIKQDQYDKQLLSKIGKSQLDELSSKDLQVLAIFREMNAGTVLDPQMIKNEDVSEKEYAAVSQQLSKLPGVNTSMDWDRKYPYGDTLRGIFGDVSTPAEGIPKELTEHYLSKGYSRNDRVGKSYLEYQYEDVLRGKKKEMKYTTDKSGKVTSSEVLNPGARGQDLKLTIDIDLQKEVEALLDKQIKKLRSQGAKDMDNAMMVVQNPKNGDILALAGKQINKSGKMTDYDIGTFTSQFAVGSSVKGGTLLAGYQNKAIKVGETMVDEPLHFQGGLTKRSYFNKNGHVTINDKQALMHSSNVYMFKTALKLAGDPYYSGMALPSDISSPAQKLRRGLNQVGLGVKTGIDLPNETRGQIEPLTNNPGNYLDLSIGQYDTYTPLQLSQYVSTIANDGYRIQPHIGLTIHESTNKDEVGPLKKKINGTVLNKVNNTEKEIKQIQEGFKMAFNDKDGTGYVSFKDTVVPTAGKTGTAEVFQNGEPRVNSTYIGYAPIDDPKLAFSIVYTNQPVPPPWLTGGDLGRDVINYYFKQLGKDDKNKDKDK

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119

Relevant publications[edit source | edit]