From AureoWiki
Jump to: navigation, search

NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1758 [new locus tag: SACOL_RS08990 ]
  • pan locus tag?: SAUPAN004361000
  • symbol: ald2
  • pan gene symbol?: ald2
  • synonym:
  • product: alanine dehydrogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL1758 [new locus tag: SACOL_RS08990 ]
  • symbol: ald2
  • product: alanine dehydrogenase
  • replicon: chromosome
  • strand: -
  • coordinates: 1797492..1798610
  • length: 1119
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGAAAATTGGTATACCAAGGGAGATTAAAAATAATGAAAATCGTGTTGGTTTATCACCA
    AGTGGTGTGCACGCTTTAGTAGAAAGTGGGCATACTGTTTTAGTGGAAACAAATGCGGGT
    TCAGGATCATTCTTTGAAGATGTAGATTACAAAGAAGCAGGTGCTGAGATTGTTGCTGAA
    CAAGCAAAAGTTTGGGATGTGGATATGGTTATTAAAGTTAAAGAACCACTTGAATCTGAA
    TATCCATATTTTAAAGAAGGGCTTGTATTATTCACTTATCTTCATTTAGCAAATGAAGAA
    AAATTAACACAAGCTTTGATAGATAGAAAAGTAATTAGTATTGCATATGAGACTGTGCAG
    TTACCAGACCGATCTTTACCATTGTTATCACCAATGAGTGAGGTAGCAGGAAGAATGTCA
    GCTCAAGTTGGCGCAGAGTTCCTACAAAAACTTAATGGTGGTATGGGAATTCTACTAGGT
    GGTGTCCCAGGAGTACCTAAGGGTAAAGTAACTATTATCGGTGGTGGTCAAGCAGGAACA
    AATGCAGCTAAAATTGCACTAGGACTAGGTGCAGATGTTACGATTTTAGATGTTAATCCA
    AAGCGTTTACAACAATTAGATGATTTATTCGGTGGACGTGTACATACAATTATGTCAAAT
    CCGTTGAATATTGAGTTGTATGTTAAACAAAGTGATTTAGTAATAGGTGCAGTTTTAATT
    CCAGGTGCTAAAGCGCCAAGACTTGTAACAGAAGACATGATTAAACAAATGAAAAATGGG
    TCAGTTATTATTGACATTGCTATTGATCAAGGCGGTATTTTTGAAACAACTGATAAAATT
    ACGACACATGATGATCCTACATATATTAAGCATGGTGTGGTTCATTATGCAGTTGCAAAT
    ATGCCAGGTGCAGTACCGCGTACTTCGACGTTAGCTTTAAATAATGCTACGCTACCTTAT
    GCGCTCATGCTAGCTAATAAAGGGTATAGAGAAGCATTTAAATCAAATCAACCATTATCA
    TTAGGTTTAAATACTTACAAAGGTCACGTAACCAATAAAGGCGTTGCAGAGGCATTTGAA
    ATGGAATATAAATCTGTAGAAGAAGCATTACAATTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1119

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL1758 [new locus tag: SACOL_RS08990 ]
  • symbol: Ald2
  • description: alanine dehydrogenase
  • length: 372
  • theoretical pI: 5.6562
  • theoretical MW: 40104.9
  • GRAVY: -0.0215054

Function[edit source | edit]

  • reaction:
    EC 1.4.1.1?  ExPASy
    Alanine dehydrogenaseL-alanine + H2O + NAD+ = pyruvate + NH3 + NADH
  • TIGRFAM:
    MetabolismEnergy metabolismAmino acids and aminesalanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 575.8)
    and 15 more
    MetabolismEnergy metabolismElectron transportNAD(P)(+) transhydrogenase (AB-specific), alpha subunit (TIGR00561; EC 1.6.1.2; HMM-score: 151.3)
    Cellular processesCellular processesSporulation and germinationdipicolinic acid synthetase, A subunit (TIGR02853; HMM-score: 26.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminglutamyl-tRNA reductase (TIGR01035; EC 1.2.1.70; HMM-score: 19.3)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 18.6)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 16)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 15.8)
    MetabolismEnergy metabolismAmino acids and aminesadenosylhomocysteinase (TIGR00936; EC 3.3.1.1; HMM-score: 13.8)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisphosphoribosylaminoimidazole carboxylase, ATPase subunit (TIGR01161; EC 4.1.1.21; HMM-score: 13.3)
    6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase (TIGR03201; EC 1.1.1.-; HMM-score: 13.3)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 12.6)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 12.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 12.4)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 12.3)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidessurface carbohydrate biosynthesis protein (TIGR04396; HMM-score: 11.5)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 11.3)
  • TheSEED:  
    CarbohydratesCentral carbohydrate metabolismPyruvate Alanine Serine Interconversions Alanine dehydrogenase (EC 1.4.1.1) 
  • PFAM:
    NADP_Rossmann (CL0063) AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 284.6)
    and 15 more
    Form_Glyc_dh (CL0325) AlaDh_PNT_N; Alanine dehydrogenase/PNT, N-terminal domain (PF05222; HMM-score: 155.2)
    NADP_Rossmann (CL0063) 2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 30.3)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 26.5)
    Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 26.5)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 21.1)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 18.5)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 18.3)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 17.1)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 16.9)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 16.8)
    THF_DHG_CYH_C; Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (PF02882; HMM-score: 16.6)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 14.1)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 13.7)
    AdoHcyase_NAD; S-adenosyl-L-homocysteine hydrolase, NAD binding domain (PF00670; HMM-score: 13.1)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 12.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.144
    • Ymax_pos: 26
    • Cmax: 0.13
    • Cmax_pos: 26
    • Smax: 0.217
    • Smax_pos: 32
    • Smean: 0.162
    • D: 0.151
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKIGIPREIKNNENRVGLSPSGVHALVESGHTVLVETNAGSGSFFEDVDYKEAGAEIVAEQAKVWDVDMVIKVKEPLESEYPYFKEGLVLFTYLHLANEEKLTQALIDRKVISIAYETVQLPDRSLPLLSPMSEVAGRMSAQVGAEFLQKLNGGMGILLGGVPGVPKGKVTIIGGGQAGTNAAKIALGLGADVTILDVNPKRLQQLDDLFGGRVHTIMSNPLNIELYVKQSDLVIGAVLIPGAKAPRLVTEDMIKQMKNGSVIIDIAIDQGGIFETTDKITTHDDPTYIKHGVVHYAVANMPGAVPRTSTLALNNATLPYALMLANKGYREAFKSNQPLSLGLNTYKGHVTNKGVAEAFEMEYKSVEEALQL

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1] [2] [3] [4]
    quantitative data / protein copy number per cell: 36 [5]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: CcpA regulon
    CcpA(TF)important in Carbon catabolismRegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Jan Pané-Farré, Andreas Otto, Susanne Sievers, Michael Hecker, Dörte Becher
    Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach.
    J. Proteome Res.: 2010, 9(3);1579-90
    [PubMed:20108986] [WorldCat.org] [DOI] (I p)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  5. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]