From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2125 [new locus tag: SACOL_RS11120 ]
  • pan locus tag?: SAUPAN005429000
  • symbol: SACOL2125
  • pan gene symbol?: hmrA
  • synonym:
  • product: M20/M25/M40 family peptidase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2125 [new locus tag: SACOL_RS11120 ]
  • symbol: SACOL2125
  • product: M20/M25/M40 family peptidase
  • replicon: chromosome
  • strand: -
  • coordinates: 2186403..2187587
  • length: 1185
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    ATGAGTGAAAAACAACAAATTCTCGATTATATAGAAACAAATAAATATAGTTATATCGAA
    ATCAGTCATAGAATTCATGAACGTCCTGAACTTGGTAATGAAGAAATATTTGCGTCTCGA
    ACTTTAATAGATCGTTTGAAAGAGCATGATTTTGAAATTGAAACCGAGATTGCTGGGCAT
    GCAACTGGGTTTATAGCGACATATGATTCAGGACTTGACGGGCCAGCTATAGGTTTTTTA
    GCAGAATACGATGCTTTGCCAGGATTGGGTCATGCTTGTGGTCATAATATCATTGGAACT
    GCAAGTGTTCTTGGTGCAATTGGTTTGAAGCAAGTGATTGACCAAATTGGTGGTAAAGTA
    GTCGTTCTTGGATGTCCAGCTGAAGAAGGTGGGGAAAATGGTAGCGCTAAAGCTTCTTAT
    GTCAAGGCTGGTGTGATTGATCAAATAGACATTGCCTTAATGATTCATCCGGGAAATGAA
    ACTTATAAAACGATTGATACTTTGGCAGTGGATGTTTTAGATGTTAAATTTTACGGAAAA
    AGTGCTCATGCCTCTGAAAATGCAGATGAAGCGTTAAATGCATTAGACGCTATGATTAGT
    TATTTTAATGGTGTAGCACAACTACGACAACATATTAAAAAAGATCAACGTGTGCATGGT
    GTGATTTTAGATGGCGGGAAAGCAGCTAATATTATTCCAGACTATACACATGCTCGTTTT
    TATACTAGAGCAATGACGCGTAAAGAATTGGATATATTAACAGAAAAAGTAAATCAAATC
    GCACGTGGAGCTGCGATACAGACTGGTTGTGATTATGAATTTGGTCGAATTCAAAACGGT
    GTGAATGAATTCATTAAAACGCCGAAATTAGATGATTTATTTGCTAAATATGCTGAAGAA
    GTTGGTGAAGCAGTTATTGATGATGATTTTGGTTATGGCTCTACGGATACAGGGAACGTA
    AGTCATGTTGTGCCAACAATACATCCTCATATTAAAATAGGATCACGTAATTTAGTAGGA
    CATACGCATAGATTTAGAGAAGCGGCTGCGAGTGTACATGGTGATGAAGCATTAATTAAA
    GGCGCTAAAATAATGGCGTTGATGGGGTTAGAGTTAATTACAAATCAAGACGTTTATCAA
    GACATTATTGAAGAGCATGCGCATTTGAAAGGGAATGGGAAGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1185

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2125 [new locus tag: SACOL_RS11120 ]
  • symbol: SACOL2125
  • description: M20/M25/M40 family peptidase
  • length: 394
  • theoretical pI: 5.27078
  • theoretical MW: 42958.1
  • GRAVY: -0.219289

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesamidohydrolase (TIGR01891; HMM-score: 202.1)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidespeptidase, ArgE/DapE family (TIGR01910; EC 3.4.-.-; HMM-score: 44.7)
    MetabolismAmino acid biosynthesisGlutamate familyacetylornithine deacetylase (ArgE) (TIGR01892; EC 3.5.1.16; HMM-score: 18.7)
    MetabolismAmino acid biosynthesisAspartate familysuccinyl-diaminopimelate desuccinylase (TIGR01900; EC 3.5.1.18; HMM-score: 14.9)
    MetabolismAmino acid biosynthesisAspartate familysuccinyl-diaminopimelate desuccinylase (TIGR01246; EC 3.5.1.18; HMM-score: 13.7)
    N-acyl-L-amino-acid amidohydrolase (TIGR01880; EC 3.5.1.14; HMM-score: 10.7)
  • TheSEED:  
    HmrA protein involved in methicillin resistance / amidohydrolase of M40 family 
  • PFAM:
    no clan definedM20_dimer; Peptidase dimerisation domain (PF07687; HMM-score: 31.6)
    Peptidase_MH (CL0035) Peptidase_M20; Peptidase family M20/M25/M40 (PF01546; HMM-score: 29.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.091
    • Ymax_pos: 28
    • Cmax: 0.101
    • Cmax_pos: 25
    • Smax: 0.097
    • Smax_pos: 24
    • Smean: 0.075
    • D: 0.085
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSEKQQILDYIETNKYSYIEISHRIHERPELGNEEIFASRTLIDRLKEHDFEIETEIAGHATGFIATYDSGLDGPAIGFLAEYDALPGLGHACGHNIIGTASVLGAIGLKQVIDQIGGKVVVLGCPAEEGGENGSAKASYVKAGVIDQIDIALMIHPGNETYKTIDTLAVDVLDVKFYGKSAHASENADEALNALDAMISYFNGVAQLRQHIKKDQRVHGVILDGGKAANIIPDYTHARFYTRAMTRKELDILTEKVNQIARGAAIQTGCDYEFGRIQNGVNEFIKTPKLDDLFAKYAEEVGEAVIDDDFGYGSTDTGNVSHVVPTIHPHIKIGSRNLVGHTHRFREAAASVHGDEALIKGAKIMALMGLELITNQDVYQDIIEEHAHLKGNGK

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4]
    quantitative data / protein copy number per cell: 135 [5]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: CodY
    CodY (TF) important in Amino acid metabolism  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: 48.39 h [6]

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3

Relevant publications[edit source | edit]