From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2147 [new locus tag: SACOL_RS11240 ]
  • pan locus tag?: SAUPAN005496000
  • symbol: SACOL2147
  • pan gene symbol?: mtlR
  • synonym:
  • product: BglG family transcriptional antiterminator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2147 [new locus tag: SACOL_RS11240 ]
  • symbol: SACOL2147
  • product: BglG family transcriptional antiterminator
  • replicon: chromosome
  • strand: +
  • coordinates: 2210386..2212518
  • length: 2133
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    ATGTTATTGAGTACACGTGAAAAAGAAATGATAGCCCTATTGATTAAGTACCACGGTCAA
    TATATCACTATACACGACATTGCTCAGCAACTTGCGGTGTCCTCTCGTACTATTCACCGT
    GAATTAAAAGGTGTTGAAGCATATTTAACTTCATTTTCATTAACTTTAGAACGCGCAAAC
    AAAAAAGGGCTACGCATTGCTGGCACAGATTCTGATTTAAACGATTTGAAGCAATCGATT
    GCACAACATCAAACCATTGACTTATCTGTTGAAGAGCAGAAAGTAATTATTATATACGCT
    TTGATACAAGCCAAGGAGCCAGTTAAACAATATAGTTTAGCGCAAGAAATTGGCGTTTCT
    GTCCAGACTTTAGCAAAGATGTTAGATGATTTAGAGCTTGATTTAAATAAGTACCAACTA
    TCTTTATCTCGAAAGCGTGGCGAAGGCATTTACTTGGTAGGTACTGAATCAAAGAAACGT
    GAATTTTTAAGTCAATTAATGGTGAATAACTTAAATAGTACTAGCGTTTATTCAGTAATT
    GAAAATCATTTTGTCTTTCATTCATTAAATCAAATCCACAAAGACTTTGTTGACTTAGAG
    CGCATTTTTAATGTTGAAAGACTATTAATGGACTACCTAAGTGCCTTACCCTACCAACTT
    ACCGAATCAAGTTATTTAACTTTAACTGTCCATATCGTGCTCTCCATTTCACGTATAAAA
    AATGGAGAGTATGTCGCATTAAACGATGATATTTATGATTCTGTACAAAACACATTTGAA
    CACAAAGTAGCAAGCGAACTTGCTGATAAACTTGGTCAAATATATGACGTCACGTTTAAT
    CAGGCAGAAATTGCTTTCATTACTATCCATTTACGTGGAGCTAAACGAAAAAATCTTAAT
    GATACATCATTAAATAATCGTTGTGAAGAAAACAAAATTAAAGCGTTTGTTAACAAAGTA
    GAAATGATTTCCGGTATGACATTTGCAGATTTGGATACTTTAGTAGATGGACTGACGCTA
    CACCTTAATCCTGCAATCAATCGTTTGCAAGCTAATATCGAGACCTATAATCCGTTAACA
    GACATGATTAAGTTCAAATATCCAAGACTATTTGAAAATGTAAGATTAGCTTTAAATGAT
    TGTTGGCCTGATTTGATTTTTCCAGAGAGTGAAATTGCTTTTATAGTTTTACACTTTGGT
    GGCTCGATTAAAAACCAAGGTAATCGATTTTTAAACATATTAGTCGTTTGCAGCAGTGGT
    ATGGGAACTAGTCGTCTATTATCAACTCGTCTAGAGCAAGTTTTTAGTGAGATTGAGCGT
    ATTACACAAGCATCAGTCAGCGATTTGAAGTCACTAGATTTAAGTCAATATGATGGCATT
    ATTTCTACTGTGAATTTAGACATCGACTCCCCCTATTTAACGGTAAACCCATTATTACCA
    GATAGTGATATCAGTTATGTCGCACAGTTTTTAAATACAAAGTCTACGTTCCAAGAGACG
    CATGATAAATCATCAAACATGATTGATAAGGATGATGTTCATGTTGAAACGAAAGATGTT
    GATGGCAACACATCTTTTGAAAATGAACAAACTTCATACTTAACTTCAGTTTTCGAAAAA
    CATTTAAGTGACGAAAAATCAGAACAATTATTGCATCATATGCGTTCGGGTTTAACTTTG
    CTTGATTCAGTGAAAATAGTTAGTACCGAAGTTAAACAGTGGCAAACATATATCGCAGAT
    TATCTATATCAATGCGATGTAATAAACGATCCAACGTCATTCGCTGAACTACTAGAGCAA
    CGATTGATTGACAATCCAGGATGGATATTAAGTCCATATCCTGTTGCAATACCACACCTA
    AGAGACAATATGATTAAACACCCTATGATTCTAATCACAGTTTTAGAAGAACCGTTAACA
    TTGCCTAGTATTCAAAATGACAATCAAACAATTAAATATATGATTTCCATGTTTATTTCT
    GACAATGATTTTATGGCATCACTGGTAAGTGACTTGTCCGAATTTTTAAGTTTGAAATTA
    GAATCTATTGATACTTTTATGGAAAATCCACAGGAACTTGAAACATTATTAAGAAACAAA
    TTTTTAGAACGAATTAAAAAACAATTTATTTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2133

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2147 [new locus tag: SACOL_RS11240 ]
  • symbol: SACOL2147
  • description: BglG family transcriptional antiterminator
  • length: 710
  • theoretical pI: 4.88526
  • theoretical MW: 81145.1
  • GRAVY: -0.175493

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, fructose subfamily, IIA component (TIGR00848; EC 2.7.1.69; HMM-score: 28)
    Signal transductionSignal transductionPTSPTS system, fructose subfamily, IIA component (TIGR00848; EC 2.7.1.69; HMM-score: 28)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtheriron-sulfur cluster biosynthesis transcriptional regulator SufR (TIGR02702; HMM-score: 16.3)
    Signal transductionRegulatory functionsDNA interactionsiron-sulfur cluster biosynthesis transcriptional regulator SufR (TIGR02702; HMM-score: 16.3)
    RNA polymerase sigma-70 factor, sigma-B/F/G subfamily (TIGR02980; HMM-score: 16)
    RNA polymerase sigma factor, TIGR02999 family (TIGR02999; HMM-score: 13.6)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 13)
    Unknown functionEnzymes of unknown specificityNDMA-dependent alcohol dehydrogenase, Rxyl_3153 family (TIGR03989; EC 1.1.99.36; HMM-score: 12.9)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsPTS system, lactose/cellobiose family IIB component (TIGR00853; HMM-score: 12.7)
    Signal transductionSignal transductionPTSPTS system, lactose/cellobiose family IIB component (TIGR00853; HMM-score: 12.7)
    probable regulatory domain (TIGR03879; HMM-score: 12.6)
  • TheSEED:  
    CarbohydratesSugar alcoholsMannitol Utilization Mannitol operon activator, BglG family 
  • PFAM:
    PRD (CL0166) PRD; PRD domain (PF00874; HMM-score: 118.2)
    HTH (CL0123) Mga; Mga helix-turn-helix domain (PF05043; HMM-score: 56.7)
    HTH_11; HTH domain (PF08279; HMM-score: 50.1)
    PTase-anion_tr (CL0340) PTS_EIIA_2; Phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2 (PF00359; HMM-score: 34.4)
    Phosphatase (CL0031) PTS_IIB; PTS system, Lactose/Cellobiose specific IIB subunit (PF02302; HMM-score: 29.1)
    HTH (CL0123) HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 21.1)
    HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 20.5)
    Fe_dep_repress; Iron dependent repressor, N-terminal DNA binding domain (PF01325; HMM-score: 18.4)
    IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 18)
    HTH_10; HTH DNA binding domain (PF04967; HMM-score: 16.9)
    DUF2089; Protein of unknown function (DUF2089) (PF09862; HMM-score: 16.9)
    HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 16.4)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 15.9)
    MarR; MarR family (PF01047; HMM-score: 15.6)
    HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 14.9)
    HTH_Tnp_1_2; Helix-turn-helix of insertion element transposase (PF13022; HMM-score: 14.9)
    HTH_Mga; M protein trans-acting positive regulator (MGA) HTH domain (PF08280; HMM-score: 13.5)
    GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 13.4)
    no clan definedDUF746; Domain of Unknown Function (DUF746) (PF05344; HMM-score: 13.1)
    DUF2675; Protein of unknown function (DUF2675) (PF11247; HMM-score: 13)
    HTH (CL0123) SMC_ScpB; Segregation and condensation complex subunit ScpB (PF04079; HMM-score: 12.5)
    HTH_Tnp_ISL3; Helix-turn-helix domain of transposase family ISL3 (PF13542; HMM-score: 12.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.121
    • Ymax_pos: 11
    • Cmax: 0.107
    • Cmax_pos: 29
    • Smax: 0.233
    • Smax_pos: 2
    • Smean: 0.142
    • D: 0.129
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLLSTREKEMIALLIKYHGQYITIHDIAQQLAVSSRTIHRELKGVEAYLTSFSLTLERANKKGLRIAGTDSDLNDLKQSIAQHQTIDLSVEEQKVIIIYALIQAKEPVKQYSLAQEIGVSVQTLAKMLDDLELDLNKYQLSLSRKRGEGIYLVGTESKKREFLSQLMVNNLNSTSVYSVIENHFVFHSLNQIHKDFVDLERIFNVERLLMDYLSALPYQLTESSYLTLTVHIVLSISRIKNGEYVALNDDIYDSVQNTFEHKVASELADKLGQIYDVTFNQAEIAFITIHLRGAKRKNLNDTSLNNRCEENKIKAFVNKVEMISGMTFADLDTLVDGLTLHLNPAINRLQANIETYNPLTDMIKFKYPRLFENVRLALNDCWPDLIFPESEIAFIVLHFGGSIKNQGNRFLNILVVCSSGMGTSRLLSTRLEQVFSEIERITQASVSDLKSLDLSQYDGIISTVNLDIDSPYLTVNPLLPDSDISYVAQFLNTKSTFQETHDKSSNMIDKDDVHVETKDVDGNTSFENEQTSYLTSVFEKHLSDEKSEQLLHHMRSGLTLLDSVKIVSTEVKQWQTYIADYLYQCDVINDPTSFAELLEQRLIDNPGWILSPYPVAIPHLRDNMIKHPMILITVLEEPLTLPSIQNDNQTIKYMISMFISDNDFMASLVSDLSEFLSLKLESIDTFMENPQELETLLRNKFLERIKKQFI

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor: RpoF (SigB*) [3] [4] other strains
    RpoF  (SigB*) (sigma factor) controls a large regulon involved in stress/starvation response and adaptation
  • regulator: SACOL2147 (MtlR*)
    MtlR* (TF) important in Mannitol utilization  RegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  3. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J. Bacteriol.: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  4. Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
    The sigmaB regulon in Staphylococcus aureus and its regulation.
    Int. J. Med. Microbiol.: 2006, 296(4-5);237-58
    [PubMed:16644280] [WorldCat.org] [DOI] (P p)

Relevant publications[edit source | edit]