From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2461 [new locus tag: SACOL_RS12910 ]
  • pan locus tag?: SAUPAN006009000
  • symbol: SACOL2461
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2461 [new locus tag: SACOL_RS12910 ]
  • symbol: SACOL2461
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2520259..2521035
  • length: 777
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAGTAATACGGCACTTGGATTGACGGCATTGCTTTTAGTCATTCCGATTATCATTTCA
    TATAAAGAAGGTTTACATATTATTAAAGATTTAATTGTTGCGACATTACGAGCAGTTGTG
    CAATTAATCATTTTGGGATTTTTGCTGCATTATATTTTTAAAATAAACGATAAATGGCTG
    CTTATTTTATGTGTATTGGTCATTATTATTAATGCATCATGGAATACAATTAGTCGAGCA
    TCACCAGTGATGCATCATGTGTTTTGGATATCATTTCTAGCTATCTTCATTGGAACGGCA
    TTACCGCTTGCAGGTACTATTGCGACAGGGGCCATTCAATTTACCGCAAATGAAGTTATA
    CCTATCGGCGGCATGCTTGCAAATAATGGCTTGATTGCAATTAATTTAGCTTACCAGAAT
    TTAGATCGTGCATTCGTACAAGATGGTACTAATATTGAATCTAAATTATCACTTGCAGCT
    ACACCTAAATTGGCTTCTAAAGGTGCAATACGTGAAAGTATTCGTTTAGCTATAGTGCCA
    ACTATTGATTCGGTTAAAACATATGGGCTTGTGTCGATTCCTGGTATGATGACAGGCTTA
    ATTATTGGTGGCGTACCACCTTTACAAGCGATTAAATTTCAATTGTTAGTCGTGTTTATT
    CATACAACTGCGACCATTATGTCTGCTTTGATTGCGACATATTTAAGCTATGGTCAATTT
    TTCAATGCAAGACATCAATTAGTAGCACGAAATACTGATGTTAAGAGTGAATCATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    777

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2461 [new locus tag: SACOL_RS12910 ]
  • symbol: SACOL2461
  • description: hypothetical protein
  • length: 258
  • theoretical pI: 10.0039
  • theoretical MW: 27901.1
  • GRAVY: 0.825969

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Hypothetical proteinsConservedTIGR00245 family protein (TIGR00245; HMM-score: 220.3)
  • TheSEED:  
    MiscellaneousMiscellaneous - no subcategoryBroadly distributed proteins not in subsystems YbbM seven transmembrane helix protein 
  • PFAM:
    no clan definedUPF0014; Uncharacterised protein family (UPF0014) (PF03649; HMM-score: 220.1)
    Holin-V (CL0562) Phage_holin_5_2; Phage holin family Hol44, in holin superfamily V (PF16079; HMM-score: 13.1)
    no clan definedSm_multidrug_ex; Putative small multi-drug export protein (PF06695; HMM-score: 7.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 5
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.125
    • Ymax_pos: 11
    • Cmax: 0.196
    • Cmax_pos: 22
    • Smax: 0.226
    • Smax_pos: 1
    • Smean: 0.141
    • D: 0.131
  • predicted transmembrane helices (TMHMM): 6

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSNTALGLTALLLVIPIIISYKEGLHIIKDLIVATLRAVVQLIILGFLLHYIFKINDKWLLILCVLVIIINASWNTISRASPVMHHVFWISFLAIFIGTALPLAGTIATGAIQFTANEVIPIGGMLANNGLIAINLAYQNLDRAFVQDGTNIESKLSLAATPKLASKGAIRESIRLAIVPTIDSVKTYGLVSIPGMMTGLIIGGVPPLQAIKFQLLVVFIHTTATIMSALIATYLSYGQFFNARHQLVARNTDVKSES

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor: RpoF (SigB*) [4] [5] other strains
    RpoF  (SigB*) (sigma factor) controls a large regulon involved in stress/starvation response and adaptation
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J. Bacteriol.: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  5. Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
    The sigmaB regulon in Staphylococcus aureus and its regulation.
    Int. J. Med. Microbiol.: 2006, 296(4-5);237-58
    [PubMed:16644280] [WorldCat.org] [DOI] (P p)

Relevant publications[edit source | edit]