From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2576 [new locus tag: SACOL_RS13495 ]
  • pan locus tag?: SAUPAN006225000
  • symbol: crtN
  • pan gene symbol?: crtN
  • synonym:
  • product: squalene synthase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2576 [new locus tag: SACOL_RS13495 ]
  • symbol: crtN
  • product: squalene synthase
  • replicon: chromosome
  • strand: -
  • coordinates: 2638834..2640342
  • length: 1509
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    ATGAAGATTGCAGTAATTGGTGCAGGTGTCACAGGATTAGCAGCGGCAGCCCGTATTGCT
    TCTCAAGGTCATGAAGTGACGATATTTGAAAAAAATAATAATGTAGGCGGGTGTATGAAT
    CAATTAAAGAAAGACGGCTTTACATTTGATATGGGTCCCACAATTGTCATGATGCCAGAT
    GTTTATAAAGATGTTTTTACAGCGTGTGGTAAAAATTATGAAGATTATATTGAATTGAGA
    CAATTACGTTATATTTACGATGTGTATTTTGACCACGATGATCGTATAACGGTGCCTACA
    GATTTAGCTGAATTACAGCAAATGCTAGAAAGTATAGAACCTGGTTCAACGCATGGTTTT
    ATGTCCTTTTTAACGGATGTTTATAAAAAATATGAAATTGCACGTCGCTATTTCTTAGAA
    AGAACGTATCGCAAACCGAGTGACTTTTATAATATGACGTCACTTGTGCAAGGTGCTAAG
    TTAAAAACGTTAAATCATGCAGATCAGCTAATTGAACATTATATTGATAACGAAAAGATA
    CAAAAGCTTTTAGCGTTTCAAACGTTATACATAGGAATTGATCCAAAACGAGGCCCGTCA
    CTATATTCAATTATTCCTATGATTGAAATGATGTTTGGTGTGCATTTTATTAAAGGCGGT
    ATGTATGGCATGGCTCAAGGGCTAGCGCAATTAAATAAAGACTTAGGCGTTAATATTGAA
    CTAAATGCTGAAATTGAGCAAATTATTATTGATCCTAAATTCAAACGGGCCGATGCGATA
    AAAGTGAATGGTGACATAAGAAAATTTGATAAAATTTTATGTACGGCTGATTTCCCTAGT
    GTTGCGGAATCATTAATGCCAGATTTTGCACCTATTAAAAAGTATCCACCACATAAAATT
    GCAGACTTAGATTACTCTTGTTCAGCATTTTTAATGTATATCGGTATAGATATTGATGTG
    ACAGATCAAGTGAGACTTCATAATGTTATTTTTTCAGATGACTTTAGAGGCAATATTGAA
    GAAATATTTGAGGGACGTTTATCATATGATCCTTCTATTTATGTGTATGTACCAGCGGTC
    GCTGATAAATCACTTGCGCCAGAAGGCAAAACTGGTATTTATGTGCTAATGCCGACGCCG
    GAACTTAAAACAGGTAGCGGAATCGATTGGTCAGATGAAGCTTTGACGCAACAAATAAAG
    GAAATTATTTATCGTAAATTAGCAACGATTGAAGTATTTGAAGATATAAAATCGCATATT
    GTTTCAGAAACAATCTTTACGCCAAATGATTTTGAGCAAACGTATCATGCGAAATTTGGT
    TCGGCATTCGGTTTAATGCCAACTTTAGCGCAAAGTAATTATTATCGTCCACAAAATGTA
    TCGCGAGATTATAAAGATTTATATTTTGCAGGTGCAAGTACGCATCCAGGTGCAGGCGTT
    CCTATTGTCTTAACGAGTGCGAAAATAACTGTAGATGAAATGATTAAAGATATTGAGCGG
    GGCGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1509

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2576 [new locus tag: SACOL_RS13495 ]
  • symbol: CrtN
  • description: squalene synthase
  • length: 502
  • theoretical pI: 5.06285
  • theoretical MW: 56688.7
  • GRAVY: -0.156175

Function[edit source | edit]

  • reaction:
    EC 1.3.8.2?  ExPASy
    4,4'-diapophytoene desaturase (4,4'-diapolycopene-forming)15-cis-4,4'-diapophytoene + 4 FAD = all-trans-4,4'-diapolycopene + 4 FADH2
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 432.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 86.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercarotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 75.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprotoporphyrinogen oxidase (TIGR00562; EC 1.3.3.4; HMM-score: 46.6)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 39)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 32.1)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 31)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 28.9)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 28.3)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesUDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 27.2)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 27)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 25.8)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 25.6)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 25)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 24.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 23)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 22.3)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 20.4)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 20.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 19.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 18.7)
    MetabolismEnergy metabolismElectron transportflavocytochrome c (TIGR01813; HMM-score: 18.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 17.9)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 17.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02731; EC 1.14.99.-; HMM-score: 16.4)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 14.6)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 13.7)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 13.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridine nucleotidesL-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 13.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme A2-dehydropantoate 2-reductase (TIGR00745; EC 1.1.1.-; HMM-score: 13.4)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA:m(5)U-54 methyltransferase (TIGR00137; EC 2.1.1.74; HMM-score: 13)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 12.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminprecorrin 3B synthase CobZ (TIGR02485; HMM-score: 12.3)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 11.7)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 11)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanUDP-N-acetylmuramoylalanine--D-glutamate ligase (TIGR01087; EC 6.3.2.9; HMM-score: 10.8)
    3-hydroxyacyl-CoA dehydrogenase PaaC (TIGR02279; EC 1.1.1.-; HMM-score: 10.8)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 7.8)
  • TheSEED:  
    Fatty Acids, Lipids, and IsoprenoidsIsoprenoidsPolyprenyl Diphosphate Biosynthesis Dehydrosqualene desaturase (EC 1.14.99.-) (Diapophytoene desaturase) (4,4'-diapophytoene desaturase) 
  • PFAM:
    NADP_Rossmann (CL0063) Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 91.3)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 56.1)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 29.4)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 26.6)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 24.7)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 23.8)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 22.8)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 21.5)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 20.8)
    FMO-like; Flavin-binding monooxygenase-like (PF00743; HMM-score: 20.5)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 19.8)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 19.8)
    Thi4; Thi4 family (PF01946; HMM-score: 18.6)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 18)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 18)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 17)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 15.7)
    MCRA; MCRA family (PF06100; HMM-score: 15.4)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 15.2)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 14.9)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 13.3)
    no clan definedBromodomain; Bromodomain (PF00439; HMM-score: 12.9)
    NADP_Rossmann (CL0063) TrkA_N; TrkA-N domain (PF02254; HMM-score: 12.9)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 12.6)
    IlvN; Acetohydroxy acid isomeroreductase, NADPH-binding domain (PF07991; HMM-score: 12.4)
    no clan definedKilA-N; KilA-N domain (PF04383; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: N-terminally anchored (with CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: 0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: AAAARIAS
  • SignalP: no predicted signal peptide
    • Ymax: 0.298
    • Ymax_pos: 24
    • Cmax: 0.165
    • Cmax_pos: 24
    • Smax: 0.735
    • Smax_pos: 19
    • Smean: 0.489
    • D: 0.372
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKIAVIGAGVTGLAAAARIASQGHEVTIFEKNNNVGGCMNQLKKDGFTFDMGPTIVMMPDVYKDVFTACGKNYEDYIELRQLRYIYDVYFDHDDRITVPTDLAELQQMLESIEPGSTHGFMSFLTDVYKKYEIARRYFLERTYRKPSDFYNMTSLVQGAKLKTLNHADQLIEHYIDNEKIQKLLAFQTLYIGIDPKRGPSLYSIIPMIEMMFGVHFIKGGMYGMAQGLAQLNKDLGVNIELNAEIEQIIIDPKFKRADAIKVNGDIRKFDKILCTADFPSVAESLMPDFAPIKKYPPHKIADLDYSCSAFLMYIGIDIDVTDQVRLHNVIFSDDFRGNIEEIFEGRLSYDPSIYVYVPAVADKSLAPEGKTGIYVLMPTPELKTGSGIDWSDEALTQQIKEIIYRKLATIEVFEDIKSHIVSETIFTPNDFEQTYHAKFGSAFGLMPTLAQSNYYRPQNVSRDYKDLYFAGASTHPGAGVPIVLTSAKITVDEMIKDIERGV

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor: RpoF (SigB*) [4] [5] other strains
    RpoF  (SigB*) (sigma factor) controls a large regulon involved in stress/starvation response and adaptation
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
    The sigmaB regulon in Staphylococcus aureus and its regulation.
    Int. J. Med. Microbiol.: 2006, 296(4-5);237-58
    [PubMed:16644280] [WorldCat.org] [DOI] (P p)
  5. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J. Bacteriol.: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)

Relevant publications[edit source | edit]