From AureoWiki
Jump to: navigation, search

NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2654 [new locus tag: SACOL_RS13900 ]
  • pan locus tag?: SAUPAN006361000
  • symbol: arcC2
  • pan gene symbol?: arcC
  • synonym:
  • product: carbamate kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2654 [new locus tag: SACOL_RS13900 ]
  • symbol: arcC2
  • product: carbamate kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 2714930..2715871
  • length: 942
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGAAAGAGAAAATTGTCATTGCATTAGGCGGTAATGCGATACAGACAACAGAAGCAACA
    GCTGAAGCACAACAAACAGCTATTAGATGTGCGATGCAAAACCTTAAACCTTTATTTGAT
    TCACCAGCGCGTATTGTGATTTCACATGGTAATGGTCCACAAATTGGAAGTTTATTAATC
    CAACAAGCTAAATCGAACAGTGACACAACGCCGGCAATGCCATTGGATACTTGTGGTGCA
    ATGTCACAGGGTATGATAGGCTATTGGTTGGAAACTGAAATCAATCGCATTTTAACTGAA
    ATGAATAGTGATAGAACTGTAGGCACAATCGTTACACGTGTGGAAGTAGATAAAGATGAT
    CCACGATTTGATAACCCAACTAAACCAATTGGTCCTTTTTATACGAAAGAAGAAGTTGAA
    GAATTACAAAAAGAACAGCCAGACTCAGTCTTTAAAGAAGATGCAGGACGTGGTTATAGA
    AAAGTAGTTGCGTCACCACTACCTCAATCTATACTAGAACACCAGTTAATTCGAACTTTA
    GCAGACGGTAAAAATATTGTCATTGCATGCGGTGGTGGCGGTATTCCAGTTATAAAAAAA
    GAAAATACCTATGAAGGTGTTGAAGCGGTTATAGATAAAGATTTTGCTAGTGAGAAATTA
    GCAACGCTGATTGAAGCAGATACCTTAATGATTCTTACGAATGTAGAAAATGTATTTATT
    AACTTTAATGAACCTAATCAACAACAAATCGATGATATTGATGTAGCAACACTGAAAAAA
    TACGCGGCACAAGGTAAGTTTGTGGAAGGATCGATGTTGCCAAAAATAGAAGCTGCGATA
    CGATTTGTTGAAAGTGGGGAAAACAAAAAAGTTATCATTACCAATTTAGAGCAGGCATAC
    GAAGCTTTGATTGGTAATAAAGGTACACACATTCACATGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    942

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2654 [new locus tag: SACOL_RS13900 ]
  • symbol: ArcC2
  • description: carbamate kinase
  • length: 313
  • theoretical pI: 4.68382
  • theoretical MW: 34328.9
  • GRAVY: -0.269649

Function[edit source | edit]

  • reaction:
    EC 2.7.2.2?  ExPASy
    Carbamate kinaseATP + NH3 + CO2 = ADP + carbamoyl phosphate
  • TIGRFAM:
    MetabolismEnergy metabolismAmino acids and aminescarbamate kinase (TIGR00746; EC 2.7.2.2; HMM-score: 392.4)
    and 4 more
    MetabolismAmino acid biosynthesisGlutamate familyacetylglutamate kinase (TIGR00761; EC 2.7.2.8; HMM-score: 49.8)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate 5-kinase (TIGR01027; EC 2.7.2.11; HMM-score: 25.5)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsputative uridylate kinase (TIGR02076; EC 2.7.4.-; HMM-score: 16.7)
    MetabolismAmino acid biosynthesisGlutamate familydelta l-pyrroline-5-carboxylate synthetase (TIGR01092; HMM-score: 11.7)
  • TheSEED:  
    Amino Acids and DerivativesArginine; urea cycle, polyaminesArginine and Ornithine Degradation Carbamate kinase (EC 2.7.2.2) 
    and 2 more
    Arginine; urea cycle, polyaminesArginine Deiminase Pathway Carbamate kinase (EC 2.7.2.2) 
    Arginine; urea cycle, polyaminesPolyamine Metabolism Carbamate kinase (EC 2.7.2.2) 
  • PFAM:
    no clan definedAA_kinase; Amino acid kinase family (PF00696; HMM-score: 93.8)
    and 1 more
    P-loop_NTPase (CL0023) SKI; Shikimate kinase (PF01202; HMM-score: 18.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL2657(arcA)arginine deiminase  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1477(ilvA1)threonine dehydratase  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.237
    • Ymax_pos: 22
    • Cmax: 0.213
    • Cmax_pos: 22
    • Smax: 0.46
    • Smax_pos: 18
    • Smean: 0.218
    • D: 0.229
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKEKIVIALGGNAIQTTEATAEAQQTAIRCAMQNLKPLFDSPARIVISHGNGPQIGSLLIQQAKSNSDTTPAMPLDTCGAMSQGMIGYWLETEINRILTEMNSDRTVGTIVTRVEVDKDDPRFDNPTKPIGPFYTKEEVEELQKEQPDSVFKEDAGRGYRKVVASPLPQSILEHQLIRTLADGKNIVIACGGGGIPVIKKENTYEGVEAVIDKDFASEKLATLIEADTLMILTNVENVFINFNEPNQQQIDDIDVATLKKYAAQGKFVEGSMLPKIEAAIRFVESGENKKVIITNLEQAYEALIGNKGTHIHM

Experimental data[edit source | edit]

  • experimental localization: Cytoplasmic [2]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: SACOL2035 regulon (Rex*), SACOL2653 regulon (ArcR*), ArgR regulon, CcpA regulon
    Rex*(TF)important in Energy metabolismRegPrecise    transcription unit transferred from N315 data RegPrecise
    ArcR*(TF)important in Arginine degradationRegPrecise    transcription unit transferred from N315 data RegPrecise
    ArgR(TF)important in Arginine biosynthesis, Arginine degradationRegPrecise    transcription unit transferred from N315 data RegPrecise
    CcpA(TF)important in Carbon catabolismRegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]