From AureoWiki
Jump to: navigation, search

NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2692
  • pan locus tag?: SAUPAN006414000
  • symbol: icaC
  • pan gene symbol?: icaC
  • synonym:
  • product:

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: pseudogene
  • locus tag: SACOL2692
  • symbol: icaC
  • product:
  • replicon: chromosome
  • strand: +
  • coordinates: 2765683..2766734
  • length: 1052
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGAAAAAGATGAGACTTGAACTCGTATATTTACGTGCTATTATATGTGCAATTATTATT
    ATCACACATTTACTTACACAAATTACTTTAAAACATGAAAATATGGAGGGTGGATCCTTA
    GTGTTACAATTTTACATTCGTAATATTGTGATTTTTGGTACACCTTGCTTTATTATCTTG
    TCACAGTTACTGACAACCTTGAATTACCAAAAAGTCACCTATAGATACTTAACTACACGC
    GTAAAATATATACTTATTCCTTACATATTAATGGGATTGTTTTACAGTTATAGTGAATCA
    TTATTAACAGATTCAAGTTTCAATAAACAATTCATTGAAAATGTCCTATTAGGTCAATGG
    TATGGCTATTTTATCGTTGTTATCATGCAATTCTTTATTTTGAGTTATATCATTTTTAAA
    ATTAACTATAACCTATTCAACAGTAAAATATTATTATTGTTATCTTTTATTTTACAGCAA
    TCATTTTTATATTACTTTACGAACAACACAGCGTTTCACGATACCGTGCTACACTATTAT
    CCATTAAGTGAAAATACTATAATATTCGGATGGATTTTTTATTTCTTCTTAGGTGCATAT
    ATGGGTTATAACTACGAACGTGTATTAAATTTCTTAGAACGTTATTTAGTTATTATGATT
    GTATTAGCTGTAGCTACTTATTTTGTGTTTATTGCGTTAGCAAATGGAGACTATTGGAAC
    GTTACCAGCTTTTCATATTCATTAACACCATATAATAGTATTATGTTTATTGTTATCTTG
    GGTATTTGCACGCATTTTAAAACAATGTTATTTAATACGATTCAAATGATTAGTGCTTTC
    TCATTCTTTATTTATTTATTACATCCAATCATTCTAGACTCATTGTTTGCATATACAAAT
    ATATTTGAGATAATACAATGGTCTTTCTAGCGATATCACTACTATTCATTTTAGGATTAT
    GTATAGGTGTCGGCATGATATTGCGTGAATTCTATATCTTTAGGTTTATTATTGGAAAAC
    AACCATATAAATTGAACATTAATGCTTATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1052

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2692
  • symbol: IcaC
  • description:
  • length: 0
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit source | edit]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit source | edit]

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: CodY regulon, IcaR regulon
    CodY(TF)important in Amino acid metabolismRegPrecise    transcription unit transferred from N315 data RegPrecise
    IcaR(TF)important in Intercellular adhesionRegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]

Ursula Fluckiger, Martina Ulrich, Andrea Steinhuber, Gerd Döring, Dietrich Mack, Regine Landmann, Christiane Goerke, Christiane Wolz
Biofilm formation, icaADBC transcription, and polysaccharide intercellular adhesin synthesis by staphylococci in a device-related infection model.
Infect. Immun.: 2005, 73(3);1811-9
[PubMed:15731082] [WorldCat.org] [DOI] (P p)
C Heilmann, O Schweitzer, C Gerke, N Vanittanakom, D Mack, F Götz
Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis.
Mol. Microbiol.: 1996, 20(5);1083-91
[PubMed:8809760] [WorldCat.org] (P p)