From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS02570 [old locus tag: SACOL0509 ]
  • pan locus tag?: SAUPAN002181000
  • symbol: SACOL_RS02570
  • pan gene symbol?:
  • synonym:
  • product: DNA mismatch repair protein MutT

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS02570 [old locus tag: SACOL0509 ]
  • symbol: SACOL_RS02570
  • product: DNA mismatch repair protein MutT
  • replicon: chromosome
  • strand: +
  • coordinates: 509542..509937
  • length: 396
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (509542..509937) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    ATGATTAAATGTGTCTGTTTAGTTGAAGAAACAGCTGATAAAATATTGCTTGTTCAAGTA
    AGGAATCGCGAAAAGTATTATTTCCCGGGTGGTAAAATAGAAGAAGGGGAATCACAAGTA
    CACGCGCTGTTAAGAGAAGTAAAAGAAGAATTAAATTTAACATTAACAATGGATGAAATT
    GAATATGTCGGGACAATTGTAGGTCCTGCATATCCACAACAGGATATGTTAACTGAGTTA
    AATGGATTTCGCGCATTAACCAAAATCGATTGGGAAAACGTAACTATCAATAATGAAATT
    ACGGATATACGCTGGATTGATAAAGATAATGATGCGTTGATTGCGCCTGCTGTCAAAGTT
    TGGATTGAAACTTATGGTGGTAAACATGACAAATAA
    60
    120
    180
    240
    300
    360
    396

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS02570 [old locus tag: SACOL0509 ]
  • symbol: SACOL_RS02570
  • description: DNA mismatch repair protein MutT
  • length: 131
  • theoretical pI: 4.42501
  • theoretical MW: 15053.1
  • GRAVY: -0.317557

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairnucleoside triphosphatase YtkD (TIGR02705; EC 3.6.1.-; HMM-score: 32)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairmutator mutT protein (TIGR00586; EC 3.6.1.-; HMM-score: 30.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherisopentenyl-diphosphate delta-isomerase (TIGR02150; EC 5.3.3.2; HMM-score: 12.1)
  • TheSEED:
  • PFAM:
    NUDIX (CL0261) NUDIX; NUDIX domain (PF00293; HMM-score: 43.4)
    NUDIX_2; Nucleotide hydrolase (PF13869; HMM-score: 20.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.117
    • Ymax_pos: 11
    • Cmax: 0.109
    • Cmax_pos: 25
    • Smax: 0.174
    • Smax_pos: 20
    • Smean: 0.138
    • D: 0.125
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446511069 NCBI
  • RefSeq: WP_000588527 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MIKCVCLVEETADKILLVQVRNREKYYFPGGKIEEGESQVHALLREVKEELNLTLTMDEIEYVGTIVGPAYPQQDMLTELNGFRALTKIDWENVTINNEITDIRWIDKDNDALIAPAVKVWIETYGGKHDK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS02570 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]