From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS02970 [old locus tag: SACOL0572 ]
  • pan locus tag?: SAUPAN002292000
  • symbol: SACOL_RS02970
  • pan gene symbol?: radA
  • synonym:
  • product: DNA repair protein RadA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS02970 [old locus tag: SACOL0572 ]
  • symbol: SACOL_RS02970
  • product: DNA repair protein RadA
  • replicon: chromosome
  • strand: +
  • coordinates: 592995..594359
  • length: 1365
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (592995..594359) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    TTGGCCAAGAAAAAAGTGATTTTTGAATGTATGGCTTGTGGTTATCAATCTCCTAAATGG
    ATGGGGAAATGTCCTAATTGTGGCGCTTGGAATCAAATGGAGGAAATTGTTGAAAAAGCA
    GCCAATCCTAAACATGGAGTTAAAACCAAGGAATTAGCAGGTAAAGTACAAAAATTAAAT
    AGTATTAAACATGAAACAACGCCGAGAGTGTTAACAGATTCAGCAGAATTCAACCGTGTA
    TTAGGTGGAGGTATTGTGAGCGGATCGTTAGTACTTATTGGTGGGGATCCAGGTATTGGT
    AAGTCAACGTTACTTTTACAAATTTGTGCATCGTTATCTCAAAAGAAAAAAGTACTATAT
    ATTACTGGAGAAGAATCGCTTAGTCAGACTAAATTACGTGCAGAGCGATTAGATGAAGAT
    TCAAGTGAATTGCAAGTATTAGCTGAAACAGATCTTGAAGTTATTTATCAAACAGTAAAA
    GAAGAACAACCTGATTTATTAGTAGTGGATTCGATTCAAACAATATATCATCCTGAAATC
    AGCTCTGCGCCAGGTTCTGTTTCACAAGTTCGTGAAAGTACACAAAGTTTAATGAATATT
    GCTAAACAAATGAACATTGCAACTTTTATAGTGGGTCATGTAACGAAAGAAGGTCAAATT
    GCTGGCCCAAGATTGCTAGAACACATGGTTGATACTGTGCTTTATTTTGAAGGCGATGAA
    CACCACGCATATCGAATTTTGCGAGCTGTTAAAAACCGTTTTGGTTCAACGAATGAAATG
    GGAATCTTCGAAATGAAGCAAAGTGGATTAAAAGGTGTAAATAATCCATCTGAAATGTTT
    TTAGAAGAACGTTCAACAAATGTTCCAGGTTCAACAATTGTTGCAACCATGGAGGGAACC
    AGACCACTTTTAATAGAAGTTCAAGCGCTGGTAACTCCAACGACTTTTAACAATCCGAGA
    CGAATGGCAACAGGGATTGATCATAATCGATTAAGTTTGTTGATGGCTGTTTTGGAAAAG
    AAAGAAAATTATCTATTACAACAACAAGATGCTTATATCAAAGTAGCTGGCGGTGTAAAG
    TTAACGGAGCCAGCAGTTGATTTAAGTGTAATTGTAGCAACTGCATCTAGCTTTAAAGAT
    AAAGCTGTCGACGGATTAGATTGCTATATTGGAGAAGTTGGTTTAACGGGTGAGGTACGT
    CGTGTATCTCGGATAGAACAACGCGTGCAAGAGGCTGCAAAACTAGGTTTCAAACGTGTA
    ATTATTCCTAAAAATAATATAGGCGGATGGACATATCCTGAAGGTATACAAGTAATAGGT
    GTAACTACTGTACATGAAGTATTGTCATTTGCTCTTCATTCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1365

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS02970 [old locus tag: SACOL0572 ]
  • symbol: SACOL_RS02970
  • description: DNA repair protein RadA
  • length: 454
  • theoretical pI: 7.05095
  • theoretical MW: 49863.1
  • GRAVY: -0.169383

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA repair protein RadA (TIGR00416; HMM-score: 665.7)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 59.9)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 59.9)
    DNA repair and recombination protein RadB (TIGR02237; HMM-score: 51.9)
    KaiC domain protein, PAE1156 family (TIGR03881; HMM-score: 40.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesputative ATP-dependent protease (TIGR00764; HMM-score: 37.8)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 36.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 36.2)
    KaiC domain protein, Ph0284 family (TIGR03877; HMM-score: 30.4)
    Genetic information processingMobile and extrachromosomal element functionsProphage functionsphage replicative helicase, DnaB family (TIGR03600; HMM-score: 27.1)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairprotein RecA (TIGR02012; HMM-score: 25.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairreplicative DNA helicase (TIGR00665; EC 3.6.4.12; HMM-score: 24.8)
    KaiC domain protein, AF_0351 family (TIGR03880; HMM-score: 24.6)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesendopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 24.5)
    meiotic recombinase Dmc1 (TIGR02238; HMM-score: 21.8)
    Unknown functionGeneralMg chelatase-like protein (TIGR00368; HMM-score: 21)
    DNA repair protein RAD51 (TIGR02239; HMM-score: 20)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA repair and recombination protein RadA (TIGR02236; HMM-score: 19.9)
    Hypothetical proteinsConservedconserved hypothetical protein (TIGR02653; HMM-score: 16.8)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDnaA regulatory inactivator Hda (TIGR03420; HMM-score: 15.7)
    Cellular processesCellular processesOthercircadian clock protein KaiC (TIGR02655; EC 2.7.11.1; HMM-score: 13.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 13.8)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 13.8)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13.4)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13.4)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 9.6)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) AAA_25; AAA domain (PF13481; HMM-score: 58.2)
    ATPase; KaiC (PF06745; HMM-score: 55.7)
    Rad51; Rad51 (PF08423; HMM-score: 36.4)
    S5 (CL0329) ChlI; Subunit ChlI of Mg-chelatase (PF13541; HMM-score: 30.3)
    Lon_C; Lon protease (S16) C-terminal proteolytic domain (PF05362; HMM-score: 27.5)
    P-loop_NTPase (CL0023) DnaB_C; DnaB-like helicase C terminal domain (PF03796; HMM-score: 26.7)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 26.3)
    RecA; recA bacterial DNA recombination protein (PF00154; HMM-score: 24)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 23.3)
    AAA_24; AAA domain (PF13479; HMM-score: 23.1)
    AAA_22; AAA domain (PF13401; HMM-score: 22.6)
    AAA_14; AAA domain (PF13173; HMM-score: 22.2)
    ABC_tran; ABC transporter (PF00005; HMM-score: 20.9)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 20)
    NACHT; NACHT domain (PF05729; HMM-score: 17.9)
    NTPase_1; NTPase (PF03266; HMM-score: 17)
    CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 17)
    AAA_19; AAA domain (PF13245; HMM-score: 16.4)
    DUF2075; Uncharacterized conserved protein (DUF2075) (PF09848; HMM-score: 15.7)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 15.2)
    MCM; MCM2/3/5 family (PF00493; HMM-score: 14.1)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 14.1)
    GvpD; GvpD gas vesicle protein (PF07088; HMM-score: 13.9)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 13.7)
    AAA_30; AAA domain (PF13604; HMM-score: 13.7)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 13.4)
    KTI12; Chromatin associated protein KTI12 (PF08433; HMM-score: 13.3)
    AAA_23; AAA domain (PF13476; HMM-score: 13.1)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 13)
    DAP3; Mitochondrial ribosomal death-associated protein 3 (PF10236; HMM-score: 12.3)
    Zn_Beta_Ribbon (CL0167) RNA_POL_M_15KD; RNA polymerases M/15 Kd subunit (PF02150; HMM-score: 10.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.205
    • Ymax_pos: 23
    • Cmax: 0.154
    • Cmax_pos: 29
    • Smax: 0.479
    • Smax_pos: 14
    • Smean: 0.338
    • D: 0.257
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447007964 NCBI
  • RefSeq: WP_001085220 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MAKKKVIFECMACGYQSPKWMGKCPNCGAWNQMEEIVEKAANPKHGVKTKELAGKVQKLNSIKHETTPRVLTDSAEFNRVLGGGIVSGSLVLIGGDPGIGKSTLLLQICASLSQKKKVLYITGEESLSQTKLRAERLDEDSSELQVLAETDLEVIYQTVKEEQPDLLVVDSIQTIYHPEISSAPGSVSQVRESTQSLMNIAKQMNIATFIVGHVTKEGQIAGPRLLEHMVDTVLYFEGDEHHAYRILRAVKNRFGSTNEMGIFEMKQSGLKGVNNPSEMFLEERSTNVPGSTIVATMEGTRPLLIEVQALVTPTTFNNPRRMATGIDHNRLSLLMAVLEKKENYLLQQQDAYIKVAGGVKLTEPAVDLSVIVATASSFKDKAVDGLDCYIGEVGLTGEVRRVSRIEQRVQEAAKLGFKRVIIPKNNIGGWTYPEGIQVIGVTTVHEVLSFALHS

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS02970 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]