From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS04030 [old locus tag: SACOL0784 ]
  • pan locus tag?: SAUPAN002611000
  • symbol: SACOL_RS04030
  • pan gene symbol?: hisC
  • synonym:
  • product: histidinol-phosphate aminotransferase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS04030 [old locus tag: SACOL0784 ]
  • symbol: SACOL_RS04030
  • product: histidinol-phosphate aminotransferase
  • replicon: chromosome
  • strand: +
  • coordinates: 807523..808581
  • length: 1059
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (807523..808581) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGAAAGAACAACTTAATCAACTATCAGCATATCAGCCTGGTTTATCTCCAAGGGCATTG
    AAAGAAAAGTATGGCATTGAAGGAGATTTATATAAACTTGCATCAAATGAAAATTTGTAT
    GGACCATCGCCTAAAGTTAAAGAAGCGATATCAGCACACTTAGATGAGTTATATTATTAT
    CCTGAAACAGGATCACCGACATTAAAAGCGGCGATTAGTAAACATTTAAATGTAGATCAA
    TCACGCATTTTATTTGGTGCGGGATTAGATGAAGTTATATTAATGATTTCTAGAGCTGTA
    TTAACGCCAGGGGATACTATTGTTACAAGTGAAGCGACATTCGGTCAATATTATCACAAT
    GCGATTGTTGAATCAGCTAATGTGATACAAGTACCTTTAAAAGATGGTGGCTTCGATTTA
    GAAGGTATTTTAAAAGAAGTTAATGAAGATACGTCATTGGTATGGTTATGTAATCCAAAT
    AATCCTACAGGTACATATTTTAATCATGAGAGCTTAGATTCGTTTTTATCTCAAGTACCT
    CCACATGTACCAGTAATTATAGATGAAGCTTATTTTGAATTTGTGACAGCAGAGGACTAC
    CCGGATACACTTGCTTTGCAACAAAAATATGACAATGCTTTCTTATTACGTACATTTTCA
    AAGGCGTATGGATTAGCGGGTTTACGTGTAGGATATGTGGTAGCAAGTGAACATGCGATT
    GAAAAATGGAACATCATTAGACCACCATTTAATGTGACACGTATATCTGAATACGCAGCA
    GTTGCAGCACTTGAAGATCAACAATATTTAAAAGAGGTAACACATAAAAATAGTGTTGAA
    CGCGAAAGATTTTATCAATTACCTCAAAGTGAGTATTTCTTGCCAAGTCAAACGAATTTT
    ATATTTGTAAAAACAAAGCGGGTAAATGAACTTTATGAAGCACTTTTAAATGTAGGGTGT
    ATTACGCGACCATTTCCAACTGGTGTTAGAATTACAATTGGTTTTAAAGAACAAAATGAT
    AAAATGTTAGAAGTTTTATCAAACTTTAAATACGAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1059

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS04030 [old locus tag: SACOL0784 ]
  • symbol: SACOL_RS04030
  • description: histidinol-phosphate aminotransferase
  • length: 352
  • theoretical pI: 4.84534
  • theoretical MW: 39787.8
  • GRAVY: -0.258239

Function[edit source | edit]

  • reaction:
    EC 2.6.1.9?  ExPASy
    Histidinol-phosphate transaminaseL-histidinol phosphate + 2-oxoglutarate = 3-(imidazol-4-yl)-2-oxopropyl phosphate + L-glutamate
  • TIGRFAM:
    MetabolismAmino acid biosynthesisHistidine familyhistidinol-phosphate transaminase (TIGR01141; EC 2.6.1.9; HMM-score: 305.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminthreonine-phosphate decarboxylase (TIGR01140; EC 4.1.1.81; HMM-score: 182)
    Cellular processesCellular processesBiosynthesis of natural productscapreomycidine synthase (TIGR03947; HMM-score: 77.6)
    beta-methylarginine biosynthesis bifunctional aminotransferase (TIGR04544; EC 2.6.-.-; HMM-score: 62.1)
    LL-diaminopimelate aminotransferase (TIGR03540; EC 2.6.1.83; HMM-score: 60.9)
    succinyldiaminopimelate transaminase (TIGR03538; EC 2.6.1.17; HMM-score: 59.1)
    succinyldiaminopimelate transaminase (TIGR03537; EC 2.6.1.17; HMM-score: 58.7)
    putative C-S lyase (TIGR04350; EC 4.4.-.-; HMM-score: 53.1)
    LL-diaminopimelate aminotransferase (TIGR03542; EC 2.6.1.83; HMM-score: 50.4)
    tyrosine/nicotianamine family aminotransferase (TIGR01265; HMM-score: 49.6)
    succinyldiaminopimelate transaminase (TIGR03539; EC 2.6.1.17; HMM-score: 44.8)
    MetabolismEnergy metabolismAmino acids and aminestyrosine aminotransferase (TIGR01264; EC 2.6.1.5; HMM-score: 37.7)
    enduracididine biosynthesis enzyme MppP (TIGR04462; EC 2.-.-.-; HMM-score: 24.6)
    enduracididine biosynthesis enzyme MppQ (TIGR04461; EC 2.-.-.-; HMM-score: 22)
    MetabolismEnergy metabolismAmino acids and aminesaspartate 4-decarboxylase (TIGR03801; EC 4.1.1.12; HMM-score: 19.9)
    cystathionine beta-lyase (TIGR01329; EC 4.4.1.8; HMM-score: 18.8)
  • TheSEED:
  • PFAM:
    PLP_aminotran (CL0061) Aminotran_1_2; Aminotransferase class I and II (PF00155; HMM-score: 167.5)
    Aminotran_5; Aminotransferase class-V (PF00266; HMM-score: 20.6)
    Cys_Met_Meta_PP; Cys/Met metabolism PLP-dependent enzyme (PF01053; HMM-score: 18.8)
    Aminotran_MocR; Alanine-glyoxylate amino-transferase (PF12897; HMM-score: 17.4)
    Alliinase_C; Allinase (PF04864; HMM-score: 13.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: pyridoxal 5'-phosphate
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.126
    • Ymax_pos: 26
    • Cmax: 0.112
    • Cmax_pos: 26
    • Smax: 0.195
    • Smax_pos: 9
    • Smean: 0.144
    • D: 0.133
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446585684 NCBI
  • RefSeq: WP_000663030 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKEQLNQLSAYQPGLSPRALKEKYGIEGDLYKLASNENLYGPSPKVKEAISAHLDELYYYPETGSPTLKAAISKHLNVDQSRILFGAGLDEVILMISRAVLTPGDTIVTSEATFGQYYHNAIVESANVIQVPLKDGGFDLEGILKEVNEDTSLVWLCNPNNPTGTYFNHESLDSFLSQVPPHVPVIIDEAYFEFVTAEDYPDTLALQQKYDNAFLLRTFSKAYGLAGLRVGYVVASEHAIEKWNIIRPPFNVTRISEYAAVAALEDQQYLKEVTHKNSVERERFYQLPQSEYFLPSQTNFIFVKTKRVNELYEALLNVGCITRPFPTGVRITIGFKEQNDKMLEVLSNFKYE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS04030 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]