From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS06300 [old locus tag: SACOL1230 ]
  • pan locus tag?: SAUPAN003501000
  • symbol: SACOL_RS06300
  • pan gene symbol?: rlmN
  • synonym:
  • product: 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS06300 [old locus tag: SACOL1230 ]
  • symbol: SACOL_RS06300
  • product: 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
  • replicon: chromosome
  • strand: +
  • coordinates: 1240128..1241222
  • length: 1095
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1240128..1241222) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGATAACTGCTGAAAAGAAAAAGAAGAATAAATTTCTTCCAAATTTTGACAAGCAATCA
    ATATATTCATTGCGATTTGACGAAATGCAAAACTGGCTCGTTGAACAAGGGCAACAAAAA
    TTTCGAGCGAAACAGATTTTTGAATGGTTATATCAAAAAAGAGTAGATTCGATTGATGAA
    ATGACGAACTTATCGAAAGACTTACGACAGCTTTTAAAAGATAACTTTACTGTTACAACT
    TTAACAACTGTAGTAAAACAAGAAAGTAAAGACGGTACAATTAAATTCTTATTTGAATTA
    CAAGATGGCTATACAATTGAAACTGTTTTAATGAGACATGATTATGGAAATTCAGTATGT
    GTAACGACACAAGTAGGTTGTCGCATCGGATGTACGTTTTGTGCTTCTACACTTGGCGGC
    TTAAAAAGAAACCTTGAAGCTGGCGAAATTGTTTCACAAGTTTTAACAGTTCAAAAAGCC
    CTTGATGCTACAGAAGAGCGCGTATCTCAAATTGTCATAATGGGTATCGGTGAACCATTT
    GAAAATTATGATGAAATGATGGACTTTTTAAGAATCGTCAATGATGATAACAGTTTAAAT
    ATTGGTGCACGTCACATTACAGTATCAACATCAGGTATCATTCCTAGAATATATGACTTT
    GCGGATGAAGATATTCAAATTAATTTTGCTGTAAGCTTACACGCCGCAAAAGATGAAGTG
    CGATCACGCTTGATGCCAATTAACCGTGCATATAATGTTGAGAAGTTAATCGAAGCAATT
    CAATATTATCAAGAAAAAACAAATCGTCGTGTTACTTTTGAATATGGTCTGTTTGGTGGT
    GTGAATGACCAACTAGAACATGCAAGAGAATTAGCACATTTAATAAAAGGCTTAAACTGC
    CATGTTAACTTAATTCCTGTCAACCATGTTCCAGAAAGAAATTATGTGAAAACGGCTAAA
    AATGATATCTTTAAATTTGAAAAAGAATTAAAGAGACTAGGAATTAATGCCACAATACGT
    CGTGAACAAGGTTCGGATATTGACGCAGCTTGTGGTCAATTAAGAGCAAAGGAACGACAA
    GTAGAAACGAGGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1095

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS06300 [old locus tag: SACOL1230 ]
  • symbol: SACOL_RS06300
  • description: 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
  • length: 364
  • theoretical pI: 7.15306
  • theoretical MW: 41904.6
  • GRAVY: -0.428022

Function[edit source | edit]

  • reaction:
    EC 2.1.1.192?  ExPASy
    23S rRNA (adenine2503-C2)-methyltransferase2 S-adenosyl-L-methionine + adenine2503 in 23S rRNA + 2 reduced [2Fe-2S] ferredoxin = S-adenosyl-L-homocysteine + L-methionine + 5'-deoxyadenosine + 2-methyladenine2503 in 23S rRNA + 2 oxidized [2Fe-2S] ferredoxin2 S-adenosyl-L-methionine + adenine37 in tRNA + 2 reduced [2Fe-2S] ferredoxin = S-adenosyl-L-homocysteine + L-methionine + 5'-deoxyadenosine + 2-methyladenine37 in tRNA + 2 oxidized [2Fe-2S] ferredoxin
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modification23S rRNA (adenine(2503)-C(2))-methyltransferase (TIGR00048; EC 2.1.1.192; HMM-score: 510.6)
    Genetic information processingProtein synthesistRNA and rRNA base modification23S rRNA (adenine(2503)-C(8))-methyltransferase Cfr (TIGR04432; EC 2.1.1.224; HMM-score: 251.5)
    hopanoid biosynthesis associated radical SAM protein HpnH (TIGR03470; HMM-score: 22.6)
    Genetic information processingProtein fateProtein modification and repairanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 19.3)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotides2'-Deoxyribonucleotide metabolismanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 19.3)
    radical SAM enzyme, TIGR04100 family (TIGR04100; HMM-score: 19.1)
    Cellular processesCellular processesAdaptations to atypical conditionsKamA family protein (TIGR00238; HMM-score: 17.3)
    Genetic information processingProtein synthesistRNA and rRNA base modificationMiaB-like tRNA modifying enzyme (TIGR01579; HMM-score: 17.3)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotides2'-Deoxyribonucleotide metabolismanaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02826; EC 1.97.1.-; HMM-score: 15.1)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsmagnesium transporter (TIGR00400; HMM-score: 10.5)
  • TheSEED:
  • PFAM:
    TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 69.1)
    4Fe-4S (CL0344) Fer4_14; 4Fe-4S single cluster domain (PF13394; HMM-score: 29.7)
    Fer4_12; 4Fe-4S single cluster domain (PF13353; HMM-score: 19.4)
    no clan definedPox_RNA_Pol_22; Poxvirus RNA polymerase 22 kDa subunit (PF05273; HMM-score: 13.4)
    Peptidase_CA (CL0125) Peptidase_C23; Carlavirus endopeptidase (PF05379; HMM-score: 12.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: [4Fe-4S] cluster
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.141
    • Ymax_pos: 11
    • Cmax: 0.113
    • Cmax_pos: 38
    • Smax: 0.279
    • Smax_pos: 1
    • Smean: 0.18
    • D: 0.156
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446549551 NCBI
  • RefSeq: WP_000626897 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MITAEKKKKNKFLPNFDKQSIYSLRFDEMQNWLVEQGQQKFRAKQIFEWLYQKRVDSIDEMTNLSKDLRQLLKDNFTVTTLTTVVKQESKDGTIKFLFELQDGYTIETVLMRHDYGNSVCVTTQVGCRIGCTFCASTLGGLKRNLEAGEIVSQVLTVQKALDATEERVSQIVIMGIGEPFENYDEMMDFLRIVNDDNSLNIGARHITVSTSGIIPRIYDFADEDIQINFAVSLHAAKDEVRSRLMPINRAYNVEKLIEAIQYYQEKTNRRVTFEYGLFGGVNDQLEHARELAHLIKGLNCHVNLIPVNHVPERNYVKTAKNDIFKFEKELKRLGINATIRREQGSDIDAACGQLRAKERQVETR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS06300 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]