From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS06515 [old locus tag: SACOL1276 ]
  • pan locus tag?: SAUPAN003557000
  • symbol: SACOL_RS06515
  • pan gene symbol?: tsf
  • synonym:
  • product: elongation factor Ts

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS06515 [old locus tag: SACOL1276 ]
  • symbol: SACOL_RS06515
  • product: elongation factor Ts
  • replicon: chromosome
  • strand: +
  • coordinates: 1285544..1286425
  • length: 882
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1285544..1286425) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGGCAACTATTTCAGCAAAACTTGTTAAAGAATTACGTGAAAAAACTGGCGCGGGTATG
    ATGGATTGTAAAAAAGCGCTAACTGAAACTGATGGTGACATCGATAAAGCGATTGACTAC
    CTACGTGAAAAAGGTATTGCTAAAGCAGCTAAAAAAGCAGACCGTATTGCGGCTGAAGGT
    TTAGTACATGTAGAAACTAAAGGTAACGACGCAGTTATCGTTGAAATCAACTCTGAAACA
    GACTTTGTTGCTCGTAACGAAGGTTTCCAAGAGTTAGTTAAAGAAATCGCTAATCAAGTA
    TTAGATACAAAAGCTGAAACTGTTGAAGCTTTAATGGAAACAACTTTACCAAATGGTAAA
    TCAGTTGATGAAAGAATTAAAGAAGCAATTTCAACAATCGGTGAAAAATTAAGTGTTCGT
    CGTTTTGCTATCAGAACTAAAACTGATAACGATGCTTTCGGCGCTTACTTACACATGGGT
    GGACGCATTGGTGTATTAACAGTTGTTGAAGGTTCAACTGACGAAGAAGCAGCAAGAGAC
    GTTGCTATGCATATCGCTGCAATCAACCCTAAATATGTTTCTTCTGAACAAGTTAGCGAA
    GAAGAAATCAACCACGAAAGAGAAGTTTTAAAACAACAAGCATTAAATGAAGGTAAACCA
    GAAAACATCGTTGAAAAAATGGTGGAAGGACGTTTACGTAAATACTTACAAGAAATTTGT
    GCTGTAGATCAAGACTTCGTTAAAAACCCTGATGTAACAGTTGAAGCTTTCTTAAAAACA
    AAAGGTGGAAAACTTGTTGACTTCGTACGCTATGAAGTAGGCGAAGGTATGGAAAAACGC
    GAAGAAAACTTTGCGGATGAAGTTAAAGGACAAATGAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    882

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS06515 [old locus tag: SACOL1276 ]
  • symbol: SACOL_RS06515
  • description: elongation factor Ts
  • length: 293
  • theoretical pI: 4.76664
  • theoretical MW: 32493.7
  • GRAVY: -0.476451

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor Ts (TIGR00116; HMM-score: 389.4)
    Unknown functionGeneralDNA-binding protein, YbaB/EbfC family (TIGR00103; HMM-score: 15.2)
  • TheSEED:
  • PFAM:
    no clan definedEF_TS; Elongation factor TS (PF00889; HMM-score: 252.9)
    UBA (CL0214) HOIP-UBA; HOIP UBA domain pair (PF16678; HMM-score: 16.9)
    no clan definedKu_C; Ku70/Ku80 C-terminal arm (PF03730; HMM-score: 15.9)
    HBS1_N; HBS1 N-terminus (PF08938; HMM-score: 13.8)
    DUF3150; Protein of unknown function (DUF3150) (PF11348; HMM-score: 13.7)
    DUF2497; Protein of unknown function (DUF2497) (PF10691; HMM-score: 12.2)
    RIIa (CL0068) RIIa; Regulatory subunit of type II PKA R-subunit (PF02197; HMM-score: 11.4)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 10
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.147
    • Ymax_pos: 13
    • Cmax: 0.141
    • Cmax_pos: 50
    • Smax: 0.274
    • Smax_pos: 1
    • Smean: 0.206
    • D: 0.17
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446123532 NCBI
  • RefSeq: WP_000201387 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MATISAKLVKELREKTGAGMMDCKKALTETDGDIDKAIDYLREKGIAKAAKKADRIAAEGLVHVETKGNDAVIVEINSETDFVARNEGFQELVKEIANQVLDTKAETVEALMETTLPNGKSVDERIKEAISTIGEKLSVRRFAIRTKTDNDAFGAYLHMGGRIGVLTVVEGSTDEEAARDVAMHIAAINPKYVSSEQVSEEEINHEREVLKQQALNEGKPENIVEKMVEGRLRKYLQEICAVDQDFVKNPDVTVEAFLKTKGGKLVDFVRYEVGEGMEKREENFADEVKGQMK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS06515 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]