From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS08265 [old locus tag: SACOL1621 ]
  • pan locus tag?: SAUPAN004145000
  • symbol: SACOL_RS08265
  • pan gene symbol?: ccpN
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS08265 [old locus tag: SACOL1621 ]
  • symbol: SACOL_RS08265
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1652478..1653101
  • length: 624
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1652478..1653101) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATAGAACTCAGTCAAAGACAAGAACGAATCATCGAAATTGTTAAAACTAAAGGACCCATT
    ACTGGTGAACAAATAGCAGATAAGTTGAATTTAACAAGAGCAACGCTTAGACCAGATTTA
    GCGATATTAACAATGTCAGGTTTTTTAGAAGCGCGTCCCCGAGTTGGATATTATTATTCA
    GGTAAATCAAAAGGCAAATTTTTTAATGAAAAACTTCGACAATTTGAGGTTAAGGACTAT
    ATGTCTCAACCTGTTGTGCTAAGAGAGAATACAACAGTTTATGACGCTATTTGTACAATT
    TTTTTAGAAGATGTAAGTACATTATTTATTATTAATGAAGATAACGATTTTGTTGGTGTG
    TGTTCAAGAAAAGATTTATTAAGAGCTTCAATGATTGGAGCAGATATTCATAAAGTACCT
    ATCAGTGTAAATATGACACGTATGCCTAATGTCACTTATTTAGAGGAAAGCGAATTAGTC
    ATATACGCAGCAGATAGAATGATTGAAAAAGAAATTGATTCGATTCCAATTGTAAGAAAA
    AAAGATAATCAAAAGTATGAAGTAATTGGAAGAATTTCCAAAACAACAATAGCTAAGTTA
    TTAGTAGCATTATATAAAGAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    624

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS08265 [old locus tag: SACOL1621 ]
  • symbol: SACOL_RS08265
  • description: hypothetical protein
  • length: 207
  • theoretical pI: 8.60375
  • theoretical MW: 23735.5
  • GRAVY: -0.195169

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismEnergy metabolismSugarssugar isomerase, KpsF/GutQ family (TIGR00393; HMM-score: 28.4)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisinosine-5'-monophosphate dehydrogenase (TIGR01302; EC 1.1.1.205; HMM-score: 18.7)
    Signal transductionRegulatory functionsDNA interactionsCRISPR locus-related DNA-binding protein (TIGR01884; HMM-score: 17.5)
    MetabolismAmino acid biosynthesisSerine familycystathionine beta-synthase (TIGR01137; EC 4.2.1.22; HMM-score: 14)
  • TheSEED:
  • PFAM:
    no clan definedCBS; CBS domain (PF00571; HMM-score: 54.5)
    HTH (CL0123) HTH_11; HTH domain (PF08279; HMM-score: 49.5)
    HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 25.6)
    MarR; MarR family (PF01047; HMM-score: 20.4)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 16.5)
    HTH_Mga; M protein trans-acting positive regulator (MGA) HTH domain (PF08280; HMM-score: 15.4)
    GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 14.2)
    TFIIE_alpha; TFIIE alpha subunit (PF02002; HMM-score: 13.7)
    Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 13.6)
    HTH_20; Helix-turn-helix domain (PF12840; HMM-score: 13.1)
    DUF977; Bacterial protein of unknown function (DUF977) (PF06163; HMM-score: 12.8)
    HTH_7; Helix-turn-helix domain of resolvase (PF02796; HMM-score: 12.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.116
    • Ymax_pos: 11
    • Cmax: 0.123
    • Cmax_pos: 52
    • Smax: 0.214
    • Smax_pos: 5
    • Smean: 0.145
    • D: 0.127
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI:
  • RefSeq: WP_001789866 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MELSQRQERIIEIVKTKGPITGEQIADKLNLTRATLRPDLAILTMSGFLEARPRVGYYYSGKSKGKFFNEKLRQFEVKDYMSQPVVLRENTTVYDAICTIFLEDVSTLFIINEDNDFVGVCSRKDLLRASMIGADIHKVPISVNMTRMPNVTYLEESELVIYAADRMIEKEIDSIPIVRKKDNQKYEVIGRISKTTIAKLLVALYKE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS08265 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]