From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS08605 [old locus tag: SACOL1687 ]
  • pan locus tag?: SAUPAN004237000
  • symbol: SACOL_RS08605
  • pan gene symbol?: lytH
  • synonym:
  • product: cell wall amidase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS08605 [old locus tag: SACOL1687 ]
  • symbol: SACOL_RS08605
  • product: cell wall amidase
  • replicon: chromosome
  • strand: -
  • coordinates: 1716773..1717648
  • length: 876
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1716773..1717648) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGAAAAAAATAGAGGCATGGTTATCTAAAAAGGGTCTTAAAAATAAACGTACTCTAATA
    GTAGTGATTGCCTTTGTCTTATTTATCATCTTTTTATTTTTATTGCTGAATAGCAATAGT
    GAAGATAGTGGGAACATCACGATAACTGAAAATGCTGAATTACGTACAGGTCCAAACGCT
    GCGTATCCAGTCATATATAAAGTTGAAAAAGGTGACCATTTTAAAAAGATTGGTAAAGTA
    GGTAAATGGATTGAAGTTGAAGATACATCCAGTAATGAAAAAGGTTGGATAGCTGGATGG
    CACACAAATTTAGATATTGTCGCGGATAATACGAAGGAGAAAAATCCTTTGCAAGGTAAA
    ACAATAGTGCTTGATCCTGGTCATGGAGGTAGTGACCAGGGTGCTTCAAGCAATACTAAA
    TATAAAAGTTTAGAAAAAGATTATACGTTGAAAACAGCAAAAGAATTGCAGCGTACTTTA
    GAAAAAGAAGGCGCAACTGTTAAGATGACAAGAACAGACGATACATATGTTTCACTAGAA
    AATCGTGATATCAAAGGCGATGCCTATTTGAGTATACATAATGATGCGTTAGAATCATCT
    AATGCAAATGGAATGACAGTTTATTGGTATCATGATAATCAAAGAGCTTTAGCAGATACG
    TTAGACGCTACGATTCAGAAGAAAGGTCTACTTTCTAATCGCGGTTCAAGACAAGAAAAT
    TATCAAGTGTTAAGACAAACAAAAGTTCCTGCTGTTTTATTAGAATTAGGTTATATTAGT
    AACCCAACTGATGAAACGATGATTAAAGATCAATTACATAGACAAATTTTAGAACAAGCA
    ATTGTTGATGGCCTTAAAATTTATTTTTCTGCGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    876

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS08605 [old locus tag: SACOL1687 ]
  • symbol: SACOL_RS08605
  • description: cell wall amidase
  • length: 291
  • theoretical pI: 8.61491
  • theoretical MW: 32693.9
  • GRAVY: -0.505842

Function[edit source | edit]

  • reaction:
    EC 3.5.1.-?  ExPASy
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanN-acetylmuramoyl-L-alanine amidase CwlD (TIGR02883; EC 3.5.1.28; HMM-score: 115.1)
    Cellular processesCellular processesSporulation and germinationN-acetylmuramoyl-L-alanine amidase CwlD (TIGR02883; EC 3.5.1.28; HMM-score: 115.1)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingpreprotein translocase, SecE subunit (TIGR00964; HMM-score: 14.7)
  • TheSEED:
  • PFAM:
    Peptidase_MH (CL0035) Amidase_3; N-acetylmuramoyl-L-alanine amidase (PF01520; HMM-score: 152.3)
    SH3 (CL0010) SH3_3; Bacterial SH3 domain (PF08239; HMM-score: 31)
    SH3_4; Bacterial SH3 domain (PF06347; HMM-score: 20)
    no clan definedDUF4969; Domain of unknown function (DUF4969) (PF16339; HMM-score: 13.3)
    O-anti_assembly (CL0499) O-antigen_lig; O-antigen ligase like membrane protein (PF13425; HMM-score: 8.4)
    ABC-2 (CL0181) ABC2_membrane_3; ABC-2 family transporter protein (PF12698; HMM-score: 7.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 8.28
    • Cellwall Score: 1.71
    • Extracellular Score: 0.01
    • Internal Helix: 1
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.278
    • Ymax_pos: 43
    • Cmax: 0.197
    • Cmax_pos: 43
    • Smax: 0.522
    • Smax_pos: 36
    • Smean: 0.296
    • D: 0.285
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

  • GI: 446640454 NCBI
  • RefSeq: WP_000717800 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKKIEAWLSKKGLKNKRTLIVVIAFVLFIIFLFLLLNSNSEDSGNITITENAELRTGPNAAYPVIYKVEKGDHFKKIGKVGKWIEVEDTSSNEKGWIAGWHTNLDIVADNTKEKNPLQGKTIVLDPGHGGSDQGASSNTKYKSLEKDYTLKTAKELQRTLEKEGATVKMTRTDDTYVSLENRDIKGDAYLSIHNDALESSNANGMTVYWYHDNQRALADTLDATIQKKGLLSNRGSRQENYQVLRQTKVPAVLLELGYISNPTDETMIKDQLHRQILEQAIVDGLKIYFSA

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS08605 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]