From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS11075 [old locus tag: SACOL2117 ]
  • pan locus tag?: SAUPAN005417000
  • symbol: SACOL_RS11075
  • pan gene symbol?: fbaA
  • synonym:
  • product: fructose-bisphosphate aldolase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS11075 [old locus tag: SACOL2117 ]
  • symbol: SACOL_RS11075
  • product: fructose-bisphosphate aldolase
  • replicon: chromosome
  • strand: -
  • coordinates: 2177627..2178487
  • length: 861
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2177627..2178487) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGCCTTTAGTTTCAATGAAAGAAATGTTAATTGATGCAAAAGAAAATGGTTATGCGGTA
    GGTCAATACAATATTAATAACCTAGAATTCACTCAAGCAATTTTAGAAGCGTCACAAGAA
    GAAAATGCACCTGTAATTTTAGGTGTTTCTGAAGGTGCTGCTCGTTACATGAGCGGTTTC
    TACACAATTGTTAAAATGGTTGAAGGGTTAATGCATGACTTAAACATCACTATTCCTGTA
    GCAATCCATTTAGACCATGGTTCAAGCTTTGAAAAATGTAAAGAAGCTATCGATGCTGGT
    TTCACATCAGTAATGATCGATGCTTCACACAGCCCATTCGAAGAAAACGTAGCAACAACT
    AAAAAAGTTGTTGAATACGCTCATGAAAAAGGTGTTTCTGTAGAAGCTGAATTAGGTACT
    GTTGGTGGACAAGAAGATGATGTTGTAGCAGACGGCATCATTTATGCTGATCCTAAAGAA
    TGTCAAGAACTAGTTGAAAAAACTGGTATTGATGCATTAGCGCCAGCATTAGGTTCAGTT
    CATGGTCCATACAAAGGTGAACCAAAATTAGGATTTAAAGAAATGGAAGAAATCGGTTTA
    TCTACAGGTTTACCATTAGTATTACACGGTGGTACTGGTATCCCGACTAAAGATATCCAA
    AAAGCAATTCCATTTGGTACAGCTAAAATTAACGTAAACACTGAAAACCAAATCGCTTCA
    GCAAAAGCAGTTCGTGACGTTTTAAATAACGACAAAGAAGTTTACGATCCTCGTAAATAC
    TTAGGACCTGCACGTGAAGCCATCAAAGAAACAGTTAAAGGTAAAATTAAAGAGTTCGGT
    ACTTCTAACCGCGCTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    861

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS11075 [old locus tag: SACOL2117 ]
  • symbol: SACOL_RS11075
  • description: fructose-bisphosphate aldolase
  • length: 286
  • theoretical pI: 4.74859
  • theoretical MW: 30835.9
  • GRAVY: -0.228322

Function[edit source | edit]

  • reaction:
    EC 4.1.2.13?  ExPASy
    Fructose-bisphosphate aldolaseD-fructose 1,6-bisphosphate = glycerone phosphate + D-glyceraldehyde 3-phosphate
  • TIGRFAM:
    MetabolismEnergy metabolismGlycolysis/gluconeogenesisfructose-1,6-bisphosphate aldolase, class II (TIGR01859; EC 4.1.2.13; HMM-score: 427.6)
    MetabolismEnergy metabolismGlycolysis/gluconeogenesisketose-bisphosphate aldolase (TIGR00167; HMM-score: 379.5)
    class II aldolase, tagatose bisphosphate family (TIGR01858; EC 4.1.2.-; HMM-score: 289.7)
    fructose-bisphosphate aldolase, class II, Calvin cycle subtype (TIGR01521; EC 4.1.2.13; HMM-score: 193)
    MetabolismEnergy metabolismGlycolysis/gluconeogenesisfructose-bisphosphate aldolase, class II (TIGR01520; EC 4.1.2.13; HMM-score: 104.2)
  • TheSEED:
  • PFAM:
    TIM_barrel (CL0036) F_bP_aldolase; Fructose-bisphosphate aldolase class-II (PF01116; HMM-score: 341.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Zn2+
  • effectors:
  • protein partners:
    SACOL_RS03080elongation factor Tu  [1] (data from MRSA252)
    SACOL_RS03755LysR family transcriptional regulator  [1] (data from MRSA252)
    SACOL_RS03810hypothetical protein  [1] (data from MRSA252)
    SACOL_RS05630pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SACOL_RS0642050S ribosomal protein L19  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.118
    • Ymax_pos: 20
    • Cmax: 0.12
    • Cmax_pos: 34
    • Smax: 0.186
    • Smax_pos: 33
    • Smean: 0.13
    • D: 0.123
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447054585 NCBI
  • RefSeq: WP_001131841 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MPLVSMKEMLIDAKENGYAVGQYNINNLEFTQAILEASQEENAPVILGVSEGAARYMSGFYTIVKMVEGLMHDLNITIPVAIHLDHGSSFEKCKEAIDAGFTSVMIDASHSPFEENVATTKKVVEYAHEKGVSVEAELGTVGGQEDDVVADGIIYADPKECQELVEKTGIDALAPALGSVHGPYKGEPKLGFKEMEEIGLSTGLPLVLHGGTGIPTKDIQKAIPFGTAKINVNTENQIASAKAVRDVLNNDKEVYDPRKYLGPAREAIKETVKGKIKEFGTSNRAK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS11075 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]