From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS11675 [old locus tag: SACOL2218 ]
  • pan locus tag?: SAUPAN005681000
  • symbol: SACOL_RS11675
  • pan gene symbol?: adk
  • synonym:
  • product: adenylate kinase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS11675 [old locus tag: SACOL2218 ]
  • symbol: SACOL_RS11675
  • product: adenylate kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 2296332..2296979
  • length: 648
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2296332..2296979) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAATATCATTTTGATGGGTTTACCTGGCGCAGGTAAAGGAACTCAAGCAAGTGAAATT
    GTCAAGAAATTCCCAATACCCCACATTTCAACTGGTGACATGTTCAGAAAAGCTATAAAA
    GAAGAAACTGAATTAGGTAAAGAAGCTAAGTCTTATATGGACCGTGGCGAATTAGTTCCT
    GATGAAGTGACTGTAGGTATCGTTAAGGAAAGAATTTCTGAAGACGATGCAAAAAAAGGC
    TTTTTATTAGATGGCTTCCCAAGAACAATCGAGCAAGCTGAGGCATTAAATAATATTATG
    TCTGAGCTTGACAGAAACATTGATGCTGTCATCAATATCGAAGTTCCGGAAGAAGAATTA
    ATGAACCGTCTTACAGGTCGTCGAATCTGTGAGTCATGTGGTACAACGTATCATCTTGTA
    TTTAATCCTCCGAAGGTCGAAGGTATTTGTGATATCGATGGTGGTAAATTGTATCAACGA
    GAAGATGATAATCCTGAAACGGTAGCTAATCGTTTGAGTGTTAATATTAAACAATCTAAG
    CCTATTTTAGATTTCTATGATCAAAAAGGTGTATTGAAAAATATTGATGGTTCAAAAGAT
    ATTAGCGACGTTACCAAAGATGTCATTGATATTTTAGATCATTTGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    648

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS11675 [old locus tag: SACOL2218 ]
  • symbol: SACOL_RS11675
  • description: adenylate kinase
  • length: 215
  • theoretical pI: 4.5477
  • theoretical MW: 23974.2
  • GRAVY: -0.416279

Function[edit source | edit]

  • reaction:
    EC 2.7.4.3?  ExPASy
    Adenylate kinaseATP + AMP = 2 ADP
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsadenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 271)
    UMP-CMP kinase family (TIGR01359; EC 2.7.4.-; HMM-score: 140.9)
    adenylate kinase (TIGR01360; EC 2.7.4.3; HMM-score: 126.1)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 22.5)
    carbohydrate kinase, thermoresistant glucokinase family (TIGR01313; EC 2.7.1.-; HMM-score: 12.7)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsdTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 11.8)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) ADK; Adenylate kinase (PF00406; HMM-score: 203.5)
    AAA_17; AAA domain (PF13207; HMM-score: 112)
    no clan definedADK_lid; Adenylate kinase, active site lid (PF05191; HMM-score: 65.5)
    P-loop_NTPase (CL0023) AAA_18; AAA domain (PF13238; HMM-score: 30.2)
    AAA_33; AAA domain (PF13671; HMM-score: 28.9)
    Hydin_ADK; Hydin Adenylate kinase-like domain (PF17213; HMM-score: 19.2)
    Thymidylate_kin; Thymidylate kinase (PF02223; HMM-score: 15.4)
    KTI12; Chromatin associated protein KTI12 (PF08433; HMM-score: 14.2)
    no clan definedDUF5024; Domain of unknown function (DUF5024) (PF16427; HMM-score: 13.7)
    Zn_Beta_Ribbon (CL0167) zf-RRN7; Zinc-finger of RNA-polymerase I-specific TFIIB, Rrn7 (PF11781; HMM-score: 9.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.198
    • Ymax_pos: 18
    • Cmax: 0.213
    • Cmax_pos: 18
    • Smax: 0.264
    • Smax_pos: 17
    • Smean: 0.183
    • D: 0.192
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446944212 NCBI
  • RefSeq: WP_001021468 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNIILMGLPGAGKGTQASEIVKKFPIPHISTGDMFRKAIKEETELGKEAKSYMDRGELVPDEVTVGIVKERISEDDAKKGFLLDGFPRTIEQAEALNNIMSELDRNIDAVINIEVPEEELMNRLTGRRICESCGTTYHLVFNPPKVEGICDIDGGKLYQREDDNPETVANRLSVNIKQSKPILDFYDQKGVLKNIDGSKDISDVTKDVIDILDHL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS11675 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]