From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS12070 [old locus tag: SACOL2295 ]
  • pan locus tag?: SAUPAN005772000
  • symbol: SACOL_RS12070
  • pan gene symbol?:
  • synonym:
  • product: CHAP domain-containing protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS12070 [old locus tag: SACOL2295 ]
  • symbol: SACOL_RS12070
  • product: CHAP domain-containing protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2356052..2356552
  • length: 501
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2356052..2356552) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    ATGAAAAAATTAGTAACAGCAACTACGTTAACAGCAGGAATCGGCACAGCATTAGTAGGT
    CAAGCATATCATGCAGATGCTGCTGAAAATTATACAAATTACAACAACTATAACTACAAC
    ACGACTCAAACTACAACGACTACGACAACTACGACAACTACATCATCAATTTCACATTCT
    GGTAACTTATACACTGCAGGACAATGTACTTGGTATGTATATGATAAAGTTGGCGGAGAA
    ATCGGTTCTACTTGGGGAAATGCTAATAATTGGGCTGCTGCTGCACAAGGTGCTGGATTC
    ACAGTAAATCATACACCTTCTAAAGGCGCTATCCTACAATCTTCTGAAGGACCATTTGGT
    CACGTTGCATATGTAGAAAGTGTAAACAGTGATGGTTCAGTTACAATTTCAGAAATGAAT
    TATAGTGGCGGACCTTTCTCAGTAAGTTCTAGAACTATTTCTGCAAGTGAAGCAGGTAAC
    TACAACTACATCCATATTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    501

Protein[edit source | edit]

Protein Data Bank: 2LRJ

General[edit source | edit]

  • locus tag: SACOL_RS12070 [old locus tag: SACOL2295 ]
  • symbol: SACOL_RS12070
  • description: CHAP domain-containing protein
  • length: 166
  • theoretical pI: 5.95405
  • theoretical MW: 17424.7
  • GRAVY: -0.339759

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cell structureCell envelopeSurface structurespilus (MSHA type) biogenesis protein MshL (TIGR02519; HMM-score: 5)
  • TheSEED:
  • PFAM:
    Peptidase_CA (CL0125) CHAP; CHAP domain (PF05257; HMM-score: 53.3)
    no clan definedDicty_REP; Dictyostelium (Slime Mold) REP protein (PF05086; HMM-score: 5.7)
    B277; Family of unknown function (PF17623; HMM-score: 5.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.02
    • Extracellular Score: 9.98
    • Internal Helices: 0
  • LocateP:
  • SignalP: Signal peptide length 28 aa
    • Ymax: 0.773
    • Ymax_pos: 28
    • Cmax: 0.75
    • Cmax_pos: 28
    • Smax: 0.925
    • Smax_pos: 19
    • Smean: 0.775
    • D: 0.774
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446660363 NCBI
  • RefSeq: WP_000737709 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKKLVTATTLTAGIGTALVGQAYHADAAENYTNYNNYNYNTTQTTTTTTTTTTTSSISHSGNLYTAGQCTWYVYDKVGGEIGSTWGNANNWAAAAQGAGFTVNHTPSKGAILQSSEGPFGHVAYVESVNSDGSVTISEMNYSGGPFSVSSRTISASEAGNYNYIHI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS12070 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]