From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS12155 [old locus tag: SACOL2311 ]
  • pan locus tag?: SAUPAN005798000
  • symbol: SACOL_RS12155
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS12155 [old locus tag: SACOL2311 ]
  • symbol: SACOL_RS12155
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2373114..2373299
  • length: 186
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2373114..2373299) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    ATGACAACAGCATTAATTGGTGTAATTGTATTAATCTTACTAATTATTAGCTTTGTGCCA
    AACTACCGTGCTATGAAATCAGCAAAAGAACAAGGAAGTAATGCAACAAGAGCTACAATT
    ATGGTAGGCATAGATATTATCTTAATTGTACTTATCATCGTGACGTTATTATTAAAATAT
    ATGTAA
    60
    120
    180
    186

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS12155 [old locus tag: SACOL2311 ]
  • symbol: SACOL_RS12155
  • description: hypothetical protein
  • length: 61
  • theoretical pI: 10.3246
  • theoretical MW: 6675.29
  • GRAVY: 1.36557

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    variant surface antigen, rifin family (TIGR01477; HMM-score: 5.9)
  • TheSEED:
  • PFAM:
    no clan definedDUF3149; Protein of unknown function (DUF3149) (PF11346; HMM-score: 11.3)
    Omega_toxin (CL0083) Chi-conotoxin; chi-Conotoxin or t superfamily (PF16981; HMM-score: 10.3)
    no clan definedP12; Virus attachment protein p12 family (PF12669; HMM-score: 9.6)
    OppC_N; N-terminal TM domain of oligopeptide transport permease C (PF12911; HMM-score: 9.2)
    Adeno_E3_CR2; Adenovirus E3 region protein CR2 (PF02439; HMM-score: 9)
    Zn_Beta_Ribbon (CL0167) DUF2116; Uncharacterized protein containing a Zn-ribbon (DUF2116) (PF09889; HMM-score: 7.3)
    VSA (CL0656) RIFIN; Rifin (PF02009; HMM-score: 6.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helices: 2
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.297
    • Ymax_pos: 25
    • Cmax: 0.261
    • Cmax_pos: 25
    • Smax: 0.554
    • Smax_pos: 21
    • Smean: 0.275
    • D: 0.289
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

  • GI: 446127452 NCBI
  • RefSeq: WP_000205307 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTTALIGVIVLILLIISFVPNYRAMKSAKEQGSNATRATIMVGIDIILIVLIIVTLLLKYM

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS12155 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]