From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS13425 [old locus tag: SACOL2563 ]
  • pan locus tag?: SAUPAN006210000
  • symbol: SACOL_RS13425
  • pan gene symbol?: clpL
  • synonym:
  • product: ATP-dependent Clp protease ATP-binding subunit

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS13425 [old locus tag: SACOL2563 ]
  • symbol: SACOL_RS13425
  • product: ATP-dependent Clp protease ATP-binding subunit
  • replicon: chromosome
  • strand: +
  • coordinates: 2621890..2623995
  • length: 2106
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (2621890..2623995) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    ATGAATAACGGTTTTTTCAATAGCGACTTTGATTCAATTTTTCGAAGAATGATGAAAGAT
    ATGCAAGGTTCAAATCAAGTCGGAAACAAAAAGTACTATATTAATGGTAAAGAAGTTTCA
    CCTGAAGAACTAGCGCAACTCACACAACAAGGTGGCAATCACTCTGCTGAACAAAGTGCG
    CAAGCTTTTCAACAAGCAGCACAAAGACAACAAGGGCAACAAGGTGGCAACGGCAATTAT
    TTAGAACAAATTGGTCGTAACCTTACGCAAGAAGCACGTGACGGTTTATTAGATCCAGTC
    ATTGGTCGTGATAAAGAAATTCAAGAAACTGCTGAAGTTTTAAGTAGACGAACTAAAAAC
    AATCCTATATTAGTTGGAGAAGCTGGTGTTGGTAAAACTGCGATTGTTGAAGGTTTAGCA
    CAGGCAATCGTTGAAGGAAATGTACCAGCAGCAATCAAAGACAAAGAAATTATTTCTGTA
    GACATTTCATCATTAGAAGCTGGAACGCAATATCGTGGTGCTTTTGAAGAAAATATTCAA
    AAATTAATCGAAGGTGTTAAATCTTCACAAAATGCCGTACTATTCTTTGATGAAATCCAT
    CAAATTATCGGTTCAGGTGCCACAGGAAGTGATTCAGGTAGCAAAGGGTTATCTGATATT
    TTGAAACCTGCATTAAGTCGTGGTGAGATTTCTATTATTGGTGCAACAACACAAGATGAA
    TATCGAAACAATATTCTTAAAGATGCTGCATTAACGCGCAGATTTAATGAAGTGCTTGTT
    AATGAACCAAGCGCTAAAGATACTGTTGAAATTTTAAAAGGTATTCGCGAAAAATTCGAA
    GAACACCATCAAGTAAAATTACCAGATGACGTATTAAAAGCATGTGTTGACTTATCAATT
    CAATATATTCCACAACGATTATTACCAGATAAAGCAATCGATGTGTTAGATATTACAGCA
    GCACATTTATCTGCGCAAAGTCCAGCTGTCGATAAAGTTGAAACTGAAAAACGAATTTCT
    GAATTAGAAAATGATAAACGTAAAGCAGTAAGTGCTGAAGAATATAAAAAAGCTGACGAC
    ATTCAAAATGAAATCAAATCATTACAAGATAAATTAGAAAATAGTAATGGTGAACATACT
    GCTGTTGCTACAGTTCATGATATTTCAGATACTATTCAACGATTAACTGGTATTCCAGTT
    TCTCAAATGGATGATAACGATATTGAACGTTTAAAAAATATTTCTAATCGTTTAAGAAGT
    AAAATCATAGGTCAAGATCAAGCTGTAGAAATGGTTTCACGTGCAATTCGCCGTAATCGT
    GCTGGGTTTGATGACGGCAACCGTCCAATTGGCAGTTTCCTATTTGTTGGCCCTACTGGT
    GTTGGTAAAACAGAGCTTGCTAAACAATTAGCAATTGATTTATTTGGTAATAAAGATGCA
    CTGATTCGACTTGATATGAGTGAATATAGTGACACAACAGCTGTTTCAAAAATGATTGGT
    ACAACTGCTGGTTATGTTGGTTATGATGACAATTCAAATACGTTAACTGAAAAAGTACGC
    CGTAATCCATACTCAGTCATTCTATTTGATGAAATCGAAAAAGCAAATCCACAAATTTTA
    ACATTGTTATTACAAGTAATGGATGATGGTAATTTGACTGATGGTCAAGGTAATGTCATC
    AACTTTAAAAATACAATTATTATTTGTACATCAAATGCTGGCTTTGGCAATGGCAATGAC
    GCTGAAGAAAAAGATATTATGCACGAAATGAAAAAATTCTTCCGCCCTGAATTCCTTAAC
    CGCTTCAACGGCATCGTTGAATTCTTACATTTAGATAAAGATGCATTGCAAGATATCGTC
    AACTTATTATTAGACGATGTACAAGTTACATTAGACAAAAAAGGTATTACGATGGACGTT
    TCTCAAGATGCGAAAGATTGGTTAATTGAAGAAGGCTATGATGAAGAATTAGGTGCACGT
    CCATTAAGACGTATTGTTGAACAGCAAGTACGTGACAAAATTACAGATTACTATTTAGAT
    CATACAGACGTTAAACATGTGGATATAGATGTTGAGGATAACGAATTAGTCGTAAAAGGT
    AAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2106

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS13425 [old locus tag: SACOL2563 ]
  • symbol: SACOL_RS13425
  • description: ATP-dependent Clp protease ATP-binding subunit
  • length: 701
  • theoretical pI: 4.62942
  • theoretical MW: 77835.7
  • GRAVY: -0.506277

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent chaperone protein ClpB (TIGR03346; HMM-score: 698)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 668.9)
    Cellular processesCellular processesPathogenesistype VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 603.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 603.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 52.2)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 52.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 36)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 34.5)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 29.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 28.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 27.4)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesputative ATP-dependent protease (TIGR00764; HMM-score: 25.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 22.1)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDnaA regulatory inactivator Hda (TIGR03420; HMM-score: 20.7)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, delta' subunit (TIGR00678; EC 2.7.7.7; HMM-score: 18.5)
    Cellular processesCellular processesOthergas vesicle protein GvpN (TIGR02640; HMM-score: 16.8)
    Signal transductionRegulatory functionsDNA interactionspsp operon transcriptional activator (TIGR02974; HMM-score: 15.8)
    Signal transductionRegulatory functionsDNA interactionsPEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 14.9)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 14.1)
    Genetic information processingMobile and extrachromosomal element functionsOtherconjugative coupling factor TraD, SXT/TOL subfamily (TIGR03743; HMM-score: 12.3)
    Cellular processesCellular processesToxin production and resistanceTOMM system kinase/cyclase fusion protein (TIGR03903; HMM-score: 12)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 166.1)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 89.1)
    no clan definedClpB_D2-small; C-terminal, D2-small domain, of ClpB protein (PF10431; HMM-score: 73.8)
    P-loop_NTPase (CL0023) AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 51.5)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 50.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 47.9)
    AAA_14; AAA domain (PF13173; HMM-score: 44.9)
    AAA_22; AAA domain (PF13401; HMM-score: 37.4)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 30.9)
    DUF815; Protein of unknown function (DUF815) (PF05673; HMM-score: 27)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 25.9)
    no clan definedUVR; UvrB/uvrC motif (PF02151; HMM-score: 25.6)
    P-loop_NTPase (CL0023) NACHT; NACHT domain (PF05729; HMM-score: 25.1)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 24.9)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 23.1)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 23)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 22.8)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 22.8)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 22)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 21.2)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 21)
    AAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 21)
    AAA_18; AAA domain (PF13238; HMM-score: 20.4)
    AAA_33; AAA domain (PF13671; HMM-score: 20.2)
    AAA_24; AAA domain (PF13479; HMM-score: 19.3)
    AAA_23; AAA domain (PF13476; HMM-score: 18.1)
    AAA_30; AAA domain (PF13604; HMM-score: 17.4)
    PhoH; PhoH-like protein (PF02562; HMM-score: 16.9)
    AAA_25; AAA domain (PF13481; HMM-score: 16.8)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 16.8)
    AAA_19; AAA domain (PF13245; HMM-score: 16.6)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 15.3)
    no clan definedUnstab_antitox; Putative addiction module component (PF09720; HMM-score: 15)
    P-loop_NTPase (CL0023) Zeta_toxin; Zeta toxin (PF06414; HMM-score: 14.4)
    NTPase_1; NTPase (PF03266; HMM-score: 13.8)
    Ras; Ras family (PF00071; HMM-score: 13.5)
    DNA_pol3_delta2; DNA polymerase III, delta subunit (PF13177; HMM-score: 13.3)
    Torsin; Torsin (PF06309; HMM-score: 13.3)
    AAA_28; AAA domain (PF13521; HMM-score: 13.1)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 12.9)
    PLP_aminotran (CL0061) Aminotran_1_2; Aminotransferase class I and II (PF00155; HMM-score: 12.1)
    P-loop_NTPase (CL0023) CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 11.2)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 11.1)
    ABC_tran; ABC transporter (PF00005; HMM-score: 10.3)
    no clan definedLIM_bind; LIM-domain binding protein (PF01803; HMM-score: 9.9)
    CCDC-167; Coiled-coil domain-containing protein 167 (PF15188; HMM-score: 9.8)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.89
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.149
    • Ymax_pos: 31
    • Cmax: 0.14
    • Cmax_pos: 63
    • Smax: 0.268
    • Smax_pos: 26
    • Smean: 0.189
    • D: 0.165
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446981725 NCBI
  • RefSeq: WP_001058981 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNNGFFNSDFDSIFRRMMKDMQGSNQVGNKKYYINGKEVSPEELAQLTQQGGNHSAEQSAQAFQQAAQRQQGQQGGNGNYLEQIGRNLTQEARDGLLDPVIGRDKEIQETAEVLSRRTKNNPILVGEAGVGKTAIVEGLAQAIVEGNVPAAIKDKEIISVDISSLEAGTQYRGAFEENIQKLIEGVKSSQNAVLFFDEIHQIIGSGATGSDSGSKGLSDILKPALSRGEISIIGATTQDEYRNNILKDAALTRRFNEVLVNEPSAKDTVEILKGIREKFEEHHQVKLPDDVLKACVDLSIQYIPQRLLPDKAIDVLDITAAHLSAQSPAVDKVETEKRISELENDKRKAVSAEEYKKADDIQNEIKSLQDKLENSNGEHTAVATVHDISDTIQRLTGIPVSQMDDNDIERLKNISNRLRSKIIGQDQAVEMVSRAIRRNRAGFDDGNRPIGSFLFVGPTGVGKTELAKQLAIDLFGNKDALIRLDMSEYSDTTAVSKMIGTTAGYVGYDDNSNTLTEKVRRNPYSVILFDEIEKANPQILTLLLQVMDDGNLTDGQGNVINFKNTIIICTSNAGFGNGNDAEEKDIMHEMKKFFRPEFLNRFNGIVEFLHLDKDALQDIVNLLLDDVQVTLDKKGITMDVSQDAKDWLIEEGYDEELGARPLRRIVEQQVRDKITDYYLDHTDVKHVDIDVEDNELVVKGK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS13425 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8

Relevant publications[edit source | edit]