From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00486
  • pan locus tag?: SAUPAN002252000
  • symbol: SAOUHSC_00486
  • pan gene symbol?: ftsH
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00486
  • symbol: SAOUHSC_00486
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 483392..485485
  • length: 2094
  • essential: no [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    ATGCAGAAAGCTTTTCGCAATGTGCTAGTTATCGTAATAATAGGCGTTATTATTTTTGGT
    CTATTTTCATATTTAAACGGTAATGGAAATATGCCGAAACAGCTTACATATAATCAATTT
    ACTGAGAAGTTGGAAAAAGGTGACCTTAAAACTTTAGAAATCCAACCACAACAAAATGTC
    TATATGGTAAGTGGTAAAACGAAAAATGATGAAGACTATTCATCAACTATTTTATATAAC
    AACGAAAAAGAATTACAAAAAATTACTGATGCTGCTAAAAAGCAAAACGGTGTAAAATTA
    ACGATTAAAGAAGAAGAAAAACAAAGTGTCTTTGTGAGTATACTTTCAACATTAATTCCA
    GTTGTAGTCATAGCGTTATTATTTATTTTCTTCCTAAGCCAAGCACAAGGTGGCGGTAGT
    GGCGGTCGTATGATGAACTTTGGTAAATCTAAAGCAAAAATGTACGATAATAATAAACGT
    CGTGTTCGTTTCTCTGATGTAGCAGGGGCAGATGAAGAAAAACAAGAATTAATTGAAATT
    GTTGATTTCTTGAAAGATAATAAAAAATTCAAAGAAATGGGATCTAGGATTCCTAAAGGT
    GTCTTACTTGTTGGACCTCCAGGTACTGGTAAAACATTACTTGCTAGAGCGGTTGCAGGT
    GAAGCTGGCGCACCATTCTTCTCTATTAGTGGTTCAGACTTTGTAGAGATGTTTGTTGGT
    GTTGGTGCGAGCCGTGTTCGTGACTTATTCGATAATGCTAAGAAAAACGCGCCTTGTATC
    ATCTTTATCGATGAGATTGATGCTGTTGGTCGTCAACGTGGTGCAGGTGTTGGTGGCGGT
    CATGATGAACGTGAACAAACCCTAAACCAATTATTAGTTGAAATGGATGGTTTCGGTGAA
    AATGAAGGTATCATTATGATAGCTGCTACAAACCGTCCTGATATCCTTGACCCAGCCTTA
    TTACGTCCAGGTCGTTTTGATAGACAAATTCAAGTTGGTCGTCCAGATGTGAAAGGCCGT
    GAAGCAATTCTTCATGTTCATGCTAAAAACAAACCACTTGATGAAACGGTTGATTTAAAA
    GCAATTTCACAACGTACACCTGGTTTCTCAGGTGCTGATTTAGAGAACTTATTAAATGAA
    GCATCTTTAATTGCTGTACGTGAAGGTAAAAAGAAAATTGACATGAGAGATATCGAAGAG
    GCAACGGATAGAGTTATAGCCGGACCTGCTAAGAAATCTCGAGTTATTTCTAAGAAAGAA
    CGTAATATTGTTGCTCATCACGAAGCTGGTCATACAATTATCGGTATGGTACTTGATGAG
    GCAGAAGTAGTGCATAAAGTTACTATTGTTCCACGTGGACAAGCAGGTGGTTATGCAATG
    ATGCTACCTAAACAAGATCGTTTCTTAATGACTGAACAAGAGTTATTAGATAAAATCTGT
    GGTTTACTTGGTGGACGTGTATCAGAAGATATTAACTTTAACGAAGTATCAACAGGTGCT
    TCAAATGACTTCGAACGTGCAACACAAATCGCACGCTCAATGGTTACGCAATATGGTATG
    AGTAAAAAATTAGGACCATTACAGTTCGGTCATAGCAATGGTCAAGTATTCTTAGGTAAA
    GATATGCAAGGTGAGCCTAATTATTCAAGCCAAATCGCATATGAAATTGATAAAGAAGTT
    CAACGAATCGTTAAAGAACAATACGAACGTTGTAAACAAATTTTATTAGAGCACAAAGAA
    CAATTAATTTTAATTGCTGAAACATTATTAACAGAAGAAACATTAGTTGCTGAACAAATT
    CAATCATTATTCTACGAAGGTAAATTACCTGAAATTGATTATGATGCAGCTAAAGTTGTT
    AAAGATGAAGATTCTGAATTTAATGATGGTAAATTCGGTAAATCTTATGAAGAGATTCGT
    AAAGAGCAATTAGAAGATGGACAACGTGACGAAAGTGAAGATCGTAAAGAAGAAAAAGAT
    ATTGCTGAGGATAAAAAAGAAGCTGATAAATCTGATGAAAAAGATGAACCAGCACATCGA
    CAAGCCCCAAATATCGAAAAACCTTACGATCCAAATCACCCAGACAATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2094

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00486
  • symbol: SAOUHSC_00486
  • description: hypothetical protein
  • length: 697
  • theoretical pI: 5.24018
  • theoretical MW: 77811.9
  • GRAVY: -0.509613

Function[edit source | edit]

  • reaction:
    EC 3.4.24.-?  ExPASy
  • TIGRFAM:
    Cellular processesCellular processesCell divisionATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 791.5)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 791.5)
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 273.6)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 259.8)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesproteasome ATPase (TIGR03689; EC 3.6.4.8; HMM-score: 143.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 28.8)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 26.8)
    Cellular processesCellular processesSporulation and germinationstage V sporulation protein K (TIGR02881; HMM-score: 23.5)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 23.2)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 23.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesendopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 21.1)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 21)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 21)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 20.7)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 17.2)
    Cellular processesCellular processesOthergas vesicle protein GvpN (TIGR02640; HMM-score: 15.7)
    Unknown functionGeneralMg chelatase-like protein (TIGR00368; HMM-score: 13.7)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 13)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, delta' subunit (TIGR00678; EC 2.7.7.7; HMM-score: 12)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingpreprotein translocase, YajC subunit (TIGR00739; HMM-score: 11)
    MAST domain (TIGR04204; HMM-score: 9.1)
  • TheSEED:  
    Bacterial Cell Division Cell division protein FtsH (EC 3.4.24.-) 
    Cell division-ribosomal stress proteins cluster Cell division protein FtsH (EC 3.4.24.-) 
  • PFAM:
    Peptidase_MA (CL0126) Peptidase_M41; Peptidase family M41 (PF01434; HMM-score: 279.8)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 158.6)
    no clan definedFtsH_ext; FtsH Extracellular (PF06480; HMM-score: 52.9)
    P-loop_NTPase (CL0023) AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 23.6)
    AAA_22; AAA domain (PF13401; HMM-score: 23.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 22.6)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 20.7)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 20)
    AAA_33; AAA domain (PF13671; HMM-score: 17.8)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 16.5)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 14.3)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 13.7)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 13.4)
    AAA_18; AAA domain (PF13238; HMM-score: 12.7)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 12.6)
    AAA_28; AAA domain (PF13521; HMM-score: 11.3)
    no clan definedODV-E18; Occlusion-derived virus envelope protein ODV-E18 (PF10717; HMM-score: 10.7)
    GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 5.7)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.197
    • Ymax_pos: 31
    • Cmax: 0.148
    • Cmax_pos: 31
    • Smax: 0.418
    • Smax_pos: 1
    • Smean: 0.292
    • D: 0.234
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MQKAFRNVLVIVIIGVIIFGLFSYLNGNGNMPKQLTYNQFTEKLEKGDLKTLEIQPQQNVYMVSGKTKNDEDYSSTILYNNEKELQKITDAAKKQNGVKLTIKEEEKQSVFVSILSTLIPVVVIALLFIFFLSQAQGGGSGGRMMNFGKSKAKMYDNNKRRVRFSDVAGADEEKQELIEIVDFLKDNKKFKEMGSRIPKGVLLVGPPGTGKTLLARAVAGEAGAPFFSISGSDFVEMFVGVGASRVRDLFDNAKKNAPCIIFIDEIDAVGRQRGAGVGGGHDEREQTLNQLLVEMDGFGENEGIIMIAATNRPDILDPALLRPGRFDRQIQVGRPDVKGREAILHVHAKNKPLDETVDLKAISQRTPGFSGADLENLLNEASLIAVREGKKKIDMRDIEEATDRVIAGPAKKSRVISKKERNIVAHHEAGHTIIGMVLDEAEVVHKVTIVPRGQAGGYAMMLPKQDRFLMTEQELLDKICGLLGGRVSEDINFNEVSTGASNDFERATQIARSMVTQYGMSKKLGPLQFGHSNGQVFLGKDMQGEPNYSSQIAYEIDKEVQRIVKEQYERCKQILLEHKEQLILIAETLLTEETLVAEQIQSLFYEGKLPEIDYDAAKVVKDEDSEFNDGKFGKSYEEIRKEQLEDGQRDESEDRKEEKDIAEDKKEADKSDEKDEPAHRQAPNIEKPYDPNHPDNK

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
    Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
    BMC Genomics: 2009, 10;291
    [PubMed:19570206] [WorldCat.org] [DOI] (I e)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  3. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]