From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00721
  • pan locus tag?: SAUPAN002598000
  • symbol: SAOUHSC_00721
  • pan gene symbol?: queC
  • synonym:
  • product: 7-cyano-7-deazaguanine synthase QueC

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00721
  • symbol: SAOUHSC_00721
  • product: 7-cyano-7-deazaguanine synthase QueC
  • replicon: chromosome
  • strand: -
  • coordinates: 704266..704934
  • length: 669
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGAAAGTGTATTAAATAATGAAAAAGCCATCGTTGTCTTTAGTGGTGGTCAAGACAGT
    ACAACATGTCTCTTTTATGCAAAAAAACATTTCAAAGAAGTTGAACTCGTAACGTTTAAT
    TATGGCCAAAGACATGATACTGAAATTGAAGTCGCAAAACAAATTGCACAAGATCAAGGA
    ATGAAACATCACGTTTTAGATATGTCATTATTATCACAACTTACTCCAAACGCATTAACA
    CAACATGATATGGAAATTACTAATAATGAAGATGGTATACCTAATACATTTGTTCCAGCT
    AGAAATTTACTTTTCTTGTCGTTTGCAGGCGCTCTAGCTTATCAAATTGGGGCTAAGCAT
    ATTATTACAGGCGTATGTGAAACAGACTTTTCAGGCTACCCAGACTGTCGCGATAGTTTT
    ATAAAATCAATGAACGTAACATTAAGCCTAGCTATGGACAAAGATTTTGTCATTCATACT
    CCTTTAATGTGGTTAAACAAAGCAGAAACGTGGAAATTAAGTGATGAACTCGAAGTTTTA
    GATTATATTCGTACAAAAACATTAACATGCTATAACGGTATCATTGGGGATGGCTGTGGT
    GAATGTCCAGCTTGTCATTTACGTCAACGTGGACTAAATCAATATCTTGAAAGTAAAGGA
    GCGCTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    669

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00721
  • symbol: SAOUHSC_00721
  • description: 7-cyano-7-deazaguanine synthase QueC
  • length: 222
  • theoretical pI: 5.27733
  • theoretical MW: 24887.2
  • GRAVY: -0.186937

Function[edit source | edit]

  • reaction:
    EC 6.3.4.20?  ExPASy
    7-cyano-7-deazaguanine synthase7-carboxy-7-carbaguanine + NH3 + ATP = 7-cyano-7-carbaguanine + ADP + phosphate + H2O
  • TIGRFAM:
    Unknown functionGeneralqueuosine biosynthesis protein QueC (TIGR00364; HMM-score: 278.9)
    Hypothetical proteinsConservedTIGR00268 family protein (TIGR00268; HMM-score: 26.1)
    MetabolismAmino acid biosynthesisAspartate familyasparagine synthase (glutamine-hydrolyzing) (TIGR01536; EC 6.3.5.4; HMM-score: 26)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA(Ile)-lysidine synthetase (TIGR02432; EC 6.3.4.-; HMM-score: 23.4)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA sulfurtransferase ThiI (TIGR00342; EC 2.8.1.4; HMM-score: 21.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminetRNA sulfurtransferase ThiI (TIGR00342; EC 2.8.1.4; HMM-score: 21.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridine nucleotidesNAD+ synthetase (TIGR00552; EC 6.3.1.5; HMM-score: 20.7)
    MetabolismAmino acid biosynthesisGlutamate familyargininosuccinate synthase (TIGR00032; EC 6.3.4.5; HMM-score: 17.2)
    MJ0570-related uncharacterized domain (TIGR00290; HMM-score: 14.7)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisGMP synthase (glutamine-hydrolyzing), C-terminal domain (TIGR00884; EC 6.3.5.2; HMM-score: 13.4)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (TIGR00420; EC 2.1.1.61; HMM-score: 12.6)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfate adenylyltransferase, small subunit (TIGR02039; EC 2.7.7.4; HMM-score: 12.5)
  • TheSEED:  
    EC 6.3.4.- Ligases that form carbon-nitrogen bonds 7-cyano-7-deazaguanine synthase (EC 6.3.4.20) 
    Queuosine-Archaeosine Biosynthesis 7-cyano-7-deazaguanine synthase (EC 6.3.4.20) 
  • PFAM:
    HUP (CL0039) QueC; Queuosine biosynthesis protein QueC (PF06508; HMM-score: 291.9)
    Asn_synthase; Asparagine synthase (PF00733; HMM-score: 24.8)
    ATP_bind_3; PP-loop family (PF01171; HMM-score: 21.7)
    NAD_synthase; NAD synthase (PF02540; HMM-score: 19)
    PAPS_reduct; Phosphoadenosine phosphosulfate reductase family (PF01507; HMM-score: 17.8)
    Arginosuc_synth; Arginosuccinate synthase (PF00764; HMM-score: 16.8)
    ThiI; Thiamine biosynthesis protein (ThiI) (PF02568; HMM-score: 15.3)
    Diphthami_syn_2; Diphthamide synthase (PF01902; HMM-score: 14.2)
    TIM_barrel (CL0036) AP_endonuc_2; Xylose isomerase-like TIM barrel (PF01261; HMM-score: 13.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Zn2+
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.132
    • Ymax_pos: 28
    • Cmax: 0.132
    • Cmax_pos: 28
    • Smax: 0.216
    • Smax_pos: 26
    • Smean: 0.105
    • D: 0.122
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MESVLNNEKAIVVFSGGQDSTTCLFYAKKHFKEVELVTFNYGQRHDTEIEVAKQIAQDQGMKHHVLDMSLLSQLTPNALTQHDMEITNNEDGIPNTFVPARNLLFLSFAGALAYQIGAKHIITGVCETDFSGYPDCRDSFIKSMNVTLSLAMDKDFVIHTPLMWLNKAETWKLSDELEVLDYIRTKTLTCYNGIIGDGCGECPACHLRQRGLNQYLESKGAL

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]