From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00908
  • pan locus tag?: SAUPAN003107000
  • symbol: SAOUHSC_00908
  • pan gene symbol?: cdr
  • synonym:
  • product: coenzyme A disulfide reductase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00908
  • symbol: SAOUHSC_00908
  • product: coenzyme A disulfide reductase
  • replicon: chromosome
  • strand: -
  • coordinates: 877458..878774
  • length: 1317
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGCCCAAAATAGTCGTAGTCGGAGCAGTCGCTGGCGGTGCAACATGTGCCAGCCAAATT
    CGACGTTTAGATAAAGAAAGTGACATTATTATTTTTGAAAAAGATCGTGATATGAGCTTT
    GCTAATTGTGCATTGCCTTATGTCATTGGCGAAGTTGTTGAAGATAGAAGATATGCTTTA
    GCGTATACACCTGAAAAATTTTATGATAGAAAGCAAATTACAGTAAAAACTTATCATGAA
    GTTATTGCAATCAATGATGAAAGACAAACTGTATCTGTATTAAATAGAAAGACAAACGAA
    CAATTTGAAGAATCTTACGATAAACTCATTTTAAGCCCTGGTGCAAGTGCAAATAGCCTT
    GGCTTTGAAAGTGATATTACATTTACACTTAGAAATTTAGAAGACACTGATGCTATCGAT
    CAATTCATCAAAGCAAATCAAGTTGATAAAGTATTGGTTGTAGGTGCAGGTTATGTTTCA
    TTAGAAGTTCTTGAAAATCTTTATGAACGTGGTTTACACCCTACTTTAATTCATCGATCT
    GATAAGATAAATAAATTAATGGATGCCGACATGAATCAACCTATACTTGATGAATTAGAT
    AAGCGGGAGATTCCATACCGTTTAAATGAGGAAATTAATGCTATCAATGGAAATGAAATT
    ACATTTAAATCAGGAAAAGTTGAACATTACGATATGATTATTGAAGGTGTCGGTACTCAC
    CCCAATTCAAAATTTATCGAAAGTTCAAATATCAAACTTGATCGAAAAGGTTTCATACCG
    GTAAACGATAAATTTGAAACAAATGTTCCAAACATTTATGCAATAGGCGATATTGCAACA
    TCACATTATCGACATGTCGATCTACCGGCTAGTGTTCCTTTAGCTTGGGGCGCTCACCGT
    GCAGCAAGTATTGTTGCCGAACAAATTGCTGGAAATGACACTATTGAATTCAAAGGCTTC
    TTAGGCAACAATATTGTGAAGTTCTTTGATTATACATTTGCGAGTGTCGGCGTTAAACCA
    AACGAACTAAAGCAATTTGACTATAAAATGGTAGAAGTCACTCAAGGTGCACACGCGAAT
    TATTACCCAGGAAATTCCCCTTTACACTTAAGAGTATATTATGACACTTCAAACCGTCAG
    ATTTTAAGAGCAGCTGCAGTAGGAAAAGAAGGTGCAGATAAACGTATTGATGTACTATCG
    ATGGCAATGATGAACCAGCTAACTGTAGATGAGTTAACTGAGTTTGAAGTGGCTTATGCA
    CCACCATATAGCCACCCTAAAGATTTAATCAATATGATTGGTTACAAAGCTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1317

Protein[edit source | edit]

Protein Data Bank: 1YQZ
Protein Data Bank: 4EM3
Protein Data Bank: 4EM4
Protein Data Bank: 4EMW
Protein Data Bank: 4EQR
Protein Data Bank: 4EQS
Protein Data Bank: 4EQW
Protein Data Bank: 4EQX

General[edit source | edit]

  • locus tag: SAOUHSC_00908
  • symbol: SAOUHSC_00908
  • description: coenzyme A disulfide reductase
  • length: 438
  • theoretical pI: 5.23597
  • theoretical MW: 49289.5
  • GRAVY: -0.311416

Function[edit source | edit]

  • reaction:
    EC 1.8.1.14?  ExPASy
    CoA-disulfide reductase2 CoA + NADP+ = CoA-disulfide + NADPH
  • TIGRFAM:
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 687.1)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 104.9)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 104.5)
    Cellular processesCellular processesDetoxificationmercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 70.8)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 63.5)
    Unknown functionEnzymes of unknown specificityputative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 63.3)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 59.4)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 57.3)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 54)
    MetabolismEnergy metabolismElectron transportglutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 52.6)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 48.1)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 47.2)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 42.3)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 30.4)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 30.4)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 29.6)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 25.6)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 15.5)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 12.7)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 12.6)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 11.5)
  • TheSEED:  
    CoA-disulfide reductase (EC 1.8.1.14) 
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 172.7)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 58.8)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 51.1)
    Reductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 40.4)
    NADP_Rossmann (CL0063) K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 18.4)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 16.2)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 15.6)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 15.5)
    RNase_H (CL0219) DDE_Tnp_1; Transposase DDE domain (PF01609; HMM-score: 14.1)
    NADP_Rossmann (CL0063) Shikimate_DH; Shikimate / quinate 5-dehydrogenase (PF01488; HMM-score: 13.2)
    Methyltransf_18; Methyltransferase domain (PF12847; HMM-score: 12.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 0.83
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.167
    • Ymax_pos: 11
    • Cmax: 0.142
    • Cmax_pos: 24
    • Smax: 0.449
    • Smax_pos: 1
    • Smean: 0.234
    • D: 0.193
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MPKIVVVGAVAGGATCASQIRRLDKESDIIIFEKDRDMSFANCALPYVIGEVVEDRRYALAYTPEKFYDRKQITVKTYHEVIAINDERQTVSVLNRKTNEQFEESYDKLILSPGASANSLGFESDITFTLRNLEDTDAIDQFIKANQVDKVLVVGAGYVSLEVLENLYERGLHPTLIHRSDKINKLMDADMNQPILDELDKREIPYRLNEEINAINGNEITFKSGKVEHYDMIIEGVGTHPNSKFIESSNIKLDRKGFIPVNDKFETNVPNIYAIGDIATSHYRHVDLPASVPLAWGAHRAASIVAEQIAGNDTIEFKGFLGNNIVKFFDYTFASVGVKPNELKQFDYKMVEVTQGAHANYYPGNSPLHLRVYYDTSNRQILRAAAVGKEGADKRIDVLSMAMMNQLTVDELTEFEVAYAPPYSHPKDLINMIGYKAK

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]

J Luba, V Charrier, A Claiborne
Coenzyme A-disulfide reductase from Staphylococcus aureus: evidence for asymmetric behavior on interaction with pyridine nucleotides.
Biochemistry: 1999, 38(9);2725-37
[PubMed:10052943] [WorldCat.org] [DOI] (P p)
T Conn Mallett, Jamie R Wallen, P Andrew Karplus, Hiroaki Sakai, Tomitake Tsukihara, Al Claiborne
Structure of coenzyme A-disulfide reductase from Staphylococcus aureus at 1.54 A resolution.
Biochemistry: 2006, 45(38);11278-89
[PubMed:16981688] [WorldCat.org] [DOI] (P p)
S B delCardayre, K P Stock, G L Newton, R C Fahey, J E Davies
Coenzyme A disulfide reductase, the primary low molecular weight disulfide reductase from Staphylococcus aureus. Purification and characterization of the native enzyme.
J. Biol. Chem.: 1998, 273(10);5744-51
[PubMed:9488707] [WorldCat.org] (P p)
S B delCardayre, J E Davies
Staphylococcus aureus coenzyme A disulfide reductase, a new subfamily of pyridine nucleotide-disulfide oxidoreductase. Sequence, expression, and analysis of cdr.
J. Biol. Chem.: 1998, 273(10);5752-7
[PubMed:9488708] [WorldCat.org] (P p)