From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00934
  • pan locus tag?: SAUPAN003164000
  • symbol: spxA
  • pan gene symbol?: spxA
  • synonym:
  • product: transcriptional regulator Spx

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00934
  • symbol: spxA
  • product: transcriptional regulator Spx
  • replicon: chromosome
  • strand: +
  • coordinates: 906832..907227
  • length: 396
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    ATGGTAACATTATTTACTTCACCAAGTTGCACATCTTGCCGTAAAGCGAAAGCATGGTTA
    CAAGAACATGACATTCCGTATACGGAGCGTAATATTTTTTCTGAACATTTAACAATTGAT
    GAAATTAAGCAAATATTAAAAATGACTGAAGACGGTACTGATGAAATCATTTCTACACGT
    TCTAAAACATACCAAAAATTAAATGTTGATATTGATTCACTACCATTACAAGACTTATAT
    TCAATCATTCAAGATAATCCTGGCTTATTACGTCGTCCAATTATTTTAGATAATAAACGA
    CTACAAGTTGGTTATAATGAGGACGAGATTCGACGTTTCTTACCTAGAAAAGTTCGTACG
    TTCCAATTACAAGAAGCACAACGTATGGTTGACTAA
    60
    120
    180
    240
    300
    360
    396

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00934
  • symbol: SpxA
  • description: transcriptional regulator Spx
  • length: 131
  • theoretical pI: 6.52593
  • theoretical MW: 15440.6
  • GRAVY: -0.583206

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionstranscriptional regulator, Spx/MgsR family (TIGR01617; HMM-score: 123.8)
    Cellular processesCellular processesDetoxificationarsenate reductase (glutaredoxin) (TIGR00014; EC 1.20.4.1; HMM-score: 46)
    glutaredoxin-like protein, YruB-family (TIGR02196; HMM-score: 33.1)
    glutaredoxin-like protein NrdH (TIGR02194; HMM-score: 31.6)
    MetabolismEnergy metabolismElectron transportglutaredoxin 3 (TIGR02181; HMM-score: 21.6)
    glutaredoxin-family domain (TIGR02190; HMM-score: 19.8)
    Unknown functionGeneralnitrogenase-associated protein (TIGR01616; HMM-score: 17.9)
    glutaredoxin-like protein (TIGR02200; HMM-score: 17.5)
    Unknown functionGeneralredox-active disulfide protein 1 (TIGR00411; HMM-score: 14.1)
  • TheSEED:  
    Regulatory protein Spx 
  • PFAM:
    Thioredoxin (CL0172) ArsC; ArsC family (PF03960; HMM-score: 83.2)
    Glutaredoxin; Glutaredoxin (PF00462; HMM-score: 37.1)
    DUF1223; Protein of unknown function (DUF1223) (PF06764; HMM-score: 17.7)
    DUF836; Glutaredoxin-like domain (DUF836) (PF05768; HMM-score: 15.1)
    GST_N_3; Glutathione S-transferase, N-terminal domain (PF13417; HMM-score: 14.6)
    no clan definedAIRC; AIR carboxylase (PF00731; HMM-score: 12.2)
    PheT-TilS (CL0383) TilS_C; TilS substrate C-terminal domain (PF11734; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 0.67
    • Signal Peptide Possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.299
    • Ymax_pos: 19
    • Cmax: 0.268
    • Cmax_pos: 19
    • Smax: 0.709
    • Smax_pos: 4
    • Smean: 0.428
    • D: 0.35
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MVTLFTSPSCTSCRKAKAWLQEHDIPYTERNIFSEHLTIDEIKQILKMTEDGTDEIISTRSKTYQKLNVDIDSLPLQDLYSIIQDNPGLLRRPIILDNKRLQVGYNEDEIRRFLPRKVRTFQLQEAQRMVD

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]