From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01223
  • pan locus tag?: SAUPAN003549000
  • symbol: SAOUHSC_01223
  • pan gene symbol?: gid
  • synonym:
  • product: tRNA (uracil-5-)-methyltransferase Gid

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01223
  • symbol: SAOUHSC_01223
  • product: tRNA (uracil-5-)-methyltransferase Gid
  • replicon: chromosome
  • strand: +
  • coordinates: 1175049..1176356
  • length: 1308
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGACTCAAACTGTAAATGTAATAGGTGCTGGTCTTGCCGGTTCAGAAGCGGCATATCAA
    TTAGCTGAAAGAGGAATTAAAGTTAATCTAATAGAGATGAGACCTGTTAAACAAACACCA
    GCGCACCATACTGATAAATTTGCGGAACTTGTATGTTCCAATTCATTACGCGGAAATGCT
    TTAACTAATGGTGTGGGTGTTTTAAAAGAAGAAATGAGAAGATTGAATTCTATAATTATT
    GAAGCGGCTGATAAGGCACGAGTTCCAGCTGGTGGTGCATTAGCAGTTGATAGACACGAT
    TTTTCAGGTTATATTACTGAAACACTTAAAAATCATGAAAATATCACAGTTATTAATGAA
    GAAATTAATGCCATTCCAGATGGATACACAATTATCGCAACAGGACCACTTACTACAGAA
    ACCCTTGCGCAAGAAATAGTGGACATTACTGGTAAAGATCAACTTTATTTCTATGATGCG
    GCTGCTCCAATTATTGAAAAAGAATCTATTGATATGGATAAAGTTTACTTAAAGTCCCGT
    TATGATAAAGGTGAAGCTGCATATTTAAACTGTCCTATGACTGAGGATGAATTTAATCGC
    TTTTATGATGCAGTATTAGAAGCTGAAGTTGCGCCTGTAAATTCATTTGAAAAAGAAAAA
    TATTTCGAGGGTTGTATGCCTTTTGAAGTAATGGCAGAACGCGGACGCAAGACATTACTA
    TTTGGACCAATGAAACCAGTAGGATTAGAAGATCCAAAGACTGGGAAACGTCCTTATGCG
    GTGGTTCAATTAAGACAAGATGACGCTGCTGGTACACTCTACAATATTGTTGGCTTCCAA
    ACGCATTTAAAATGGGGAGCTCAAAAAGAAGTCATTAAATTAATTCCAGGCTTAGAAAAT
    GTTGATATTGTTAGATATGGTGTGATGCATAGAAATACCTTCATTAATTCACCGGACGTA
    TTAAACGAGAAATATGAATTGATTTCACAACCAAACATACAGTTTGCGGGACAAATGACT
    GGTGTTGAAGGTTATGTAGAAAGCGCAGCTAGCGGCTTAGTTGCAGGTATCAATCTTGCG
    CATAAAATATTAGGCAAGGGTGAGGTAGTATTTCCGAGAGAAACAATGATTGGAAGTATG
    GCTTACTATATTTCTCATGCTAAAAACAATAAGAATTTCCAACCTATGAATGCTAACTTC
    GGGTTATTACCATCTTTAGAAACTAGAATTAAAGATAAAAAAGAACGCTATGAAGCACAA
    GCTAATAGAGCTTTGGATTACTTAGAAAATTTCAAAAAAACTTTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1308

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01223
  • symbol: SAOUHSC_01223
  • description: tRNA (uracil-5-)-methyltransferase Gid
  • length: 435
  • theoretical pI: 5.53912
  • theoretical MW: 48370.9
  • GRAVY: -0.293793

Function[edit source | edit]

  • reaction:
    EC 2.1.1.74?  ExPASy
    Methylenetetrahydrofolate--tRNA-(uracil54-C5)-methyltransferase (FADH2-oxidizing)5,10-methylenetetrahydrofolate + uracil54 in tRNA + FADH2 = tetrahydrofolate + 5-methyluracil54 in tRNA + FAD
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA:m(5)U-54 methyltransferase (TIGR00137; EC 2.1.1.74; HMM-score: 723.4)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 77.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 29.2)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 27.8)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 21.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiamineglycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 20.3)
    MetabolismEnergy metabolismAmino acids and aminessarcosine oxidase, monomeric form (TIGR01377; HMM-score: 17.8)
    lycopene cyclase family protein (TIGR01790; HMM-score: 16.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherphytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 16.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinoneubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 15.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 15)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 14.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersThiaminethiazole biosynthesis enzyme (TIGR00292; HMM-score: 14.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 14.5)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 14.3)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02028; HMM-score: 13.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 13.6)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 13.6)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 13)
    MetabolismEnergy metabolismTCA cyclesuccinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01811; EC 1.3.99.1; HMM-score: 12.4)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 12.2)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 12.1)
    Cellular processesCellular processesDetoxificationalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 12)
    Cellular processesCellular processesAdaptations to atypical conditionsalkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 12)
    MetabolismEnergy metabolismAnaerobicglycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 11.3)
  • TheSEED:  
    Conserved gene cluster associated with Met-tRNA formyltransferase Methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO (EC 2.1.1.74) 
    Folate Biosynthesis Methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO (EC 2.1.1.74) 
  • PFAM:
    NADP_Rossmann (CL0063) GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 375.3)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 25.7)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 25.4)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 21.9)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 21.4)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 21.4)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 20.4)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 17.8)
    Thi4; Thi4 family (PF01946; HMM-score: 15)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 14.9)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 14.3)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 14)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 13.5)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:
    SAOUHSC_00005DNA gyrase subunit B  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.138
    • Ymax_pos: 44
    • Cmax: 0.126
    • Cmax_pos: 44
    • Smax: 0.236
    • Smax_pos: 41
    • Smean: 0.112
    • D: 0.128
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTQTVNVIGAGLAGSEAAYQLAERGIKVNLIEMRPVKQTPAHHTDKFAELVCSNSLRGNALTNGVGVLKEEMRRLNSIIIEAADKARVPAGGALAVDRHDFSGYITETLKNHENITVINEEINAIPDGYTIIATGPLTTETLAQEIVDITGKDQLYFYDAAAPIIEKESIDMDKVYLKSRYDKGEAAYLNCPMTEDEFNRFYDAVLEAEVAPVNSFEKEKYFEGCMPFEVMAERGRKTLLFGPMKPVGLEDPKTGKRPYAVVQLRQDDAAGTLYNIVGFQTHLKWGAQKEVIKLIPGLENVDIVRYGVMHRNTFINSPDVLNEKYELISQPNIQFAGQMTGVEGYVESAASGLVAGINLAHKILGKGEVVFPRETMIGSMAYYISHAKNNKNFQPMNANFGLLPSLETRIKDKKERYEAQANRALDYLENFKKTL

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]