From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01413
  • pan locus tag?: SAUPAN003827000
  • symbol: SAOUHSC_01413
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01413
  • symbol: SAOUHSC_01413
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1353324..1354115
  • length: 792
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGCACTAAAACATTATAAGAATTCAGATTCAACAGTTTTCAATGATGCGAAGGCATTA
    TTTGATTTAAATAAAAATATTTTACTTAAAGGTCCAACAGGTTCAGGGAAAACAAAGTTG
    GCAGAAACATTAAGTGAAGTTGTTGATACACCCATGCATCAAGTCAATTGTTCTGTTGAT
    TTAGATACAGAAAGCTTATTAGGCTTTAAAACAATTAAAACAAATGCGGAAGGTCAACAA
    GAAATTGTCTTTGTAGATGGTCCAGTTATTAAAGCTATGAAAGAGGGGCATATTTTATAT
    ATTGATGAAATAAATATGGCTAAACCTGAAACATTGCCTGTATTAAATGGGGTCTTAGAT
    TATCGTCGTCAAATTACGAATCCATACACTGGTGAAGTAATCAAAGCTGTACCAGGATTT
    AACGTTATAGCAGCGATAAATGAAGGTTATGTTGGTACTTTGCCAATGAATGAAGCACTA
    AAAAATCGCTTTGTTGTTATTCACGTTGATTATATTGATGGGGACATTTTAAAAAATGTG
    ATTAAAGAGCAAAGTTTATTACAAGATGATAAACAAATCGAACAAATTATTAAGTTTAAT
    GAAGATTTACGTACTATGTCTAAGCAGGGACAAATTTCTGAAGAAGCCGCTAGTATCCGT
    GCATTATTAGACTTGTGTGATTTAATCACTGTAATGCCAGTTGAACGTGCAATTAAACGT
    ACAATTATTGATAAATTGGAAGATGAACGTGAACAACAAGCAATATATAATGCTGTAGAA
    CTAAACTTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    792

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01413
  • symbol: SAOUHSC_01413
  • description: hypothetical protein
  • length: 263
  • theoretical pI: 4.68695
  • theoretical MW: 29448.6
  • GRAVY: -0.186312

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cellular processesCellular processesOthergas vesicle protein GvpN (TIGR02640; HMM-score: 75.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalamincobaltochelatase, CobS subunit (TIGR01650; EC 6.6.1.2; HMM-score: 34.8)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 30.2)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 30.2)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 27.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllmagnesium chelatase ATPase subunit D (TIGR02031; EC 6.6.1.1; HMM-score: 20.5)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 18.7)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 14.3)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 14.1)
    Cellular processesCellular processesConjugationP-type conjugative transfer ATPase TrbB (TIGR02782; HMM-score: 13.6)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 13.3)
    Unknown functionGeneralMg chelatase-like protein (TIGR00368; HMM-score: 12.2)
  • TheSEED:  
    Stress ResponseStress Response - no subcategoryFlavohaemoglobin Nitric oxide reductase activation protein NorQ 
  • PFAM:
    P-loop_NTPase (CL0023) AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 98.8)
    AAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 45.1)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 25)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 23.1)
    no clan definedCbbQ_C; CbbQ/NirQ/NorQ C-terminal (PF08406; HMM-score: 23.1)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 22.9)
    AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 21.4)
    AAA_14; AAA domain (PF13173; HMM-score: 20.9)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 19.4)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 19.1)
    AAA_18; AAA domain (PF13238; HMM-score: 17.6)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 16.5)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 16.4)
    ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 15.7)
    ABC_tran; ABC transporter (PF00005; HMM-score: 15.6)
    AAA_6; Hydrolytic ATP binding site of dynein motor region D1 (PF12774; HMM-score: 15.3)
    AAA_22; AAA domain (PF13401; HMM-score: 14.5)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 14.3)
    CPT; Chloramphenicol phosphotransferase-like protein (PF07931; HMM-score: 14.2)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 14.1)
    AAA_PrkA; PrkA AAA domain (PF08298; HMM-score: 13.8)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 13.7)
    AAA_19; AAA domain (PF13245; HMM-score: 12.5)
    NTPase_1; NTPase (PF03266; HMM-score: 12.4)
    AAA_30; AAA domain (PF13604; HMM-score: 12.1)
    AAA_24; AAA domain (PF13479; HMM-score: 12)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.138
    • Ymax_pos: 20
    • Cmax: 0.142
    • Cmax_pos: 20
    • Smax: 0.209
    • Smax_pos: 1
    • Smean: 0.145
    • D: 0.141
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MALKHYKNSDSTVFNDAKALFDLNKNILLKGPTGSGKTKLAETLSEVVDTPMHQVNCSVDLDTESLLGFKTIKTNAEGQQEIVFVDGPVIKAMKEGHILYIDEINMAKPETLPVLNGVLDYRRQITNPYTGEVIKAVPGFNVIAAINEGYVGTLPMNEALKNRFVVIHVDYIDGDILKNVIKEQSLLQDDKQIEQIIKFNEDLRTMSKQGQISEEAASIRALLDLCDLITVMPVERAIKRTIIDKLEDEREQQAIYNAVELNF

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]

Lindsey N Shaw, Joanne Aish, Jessica E Davenport, Melanie C Brown, James K Lithgow, Kay Simmonite, Howard Crossley, James Travis, Jan Potempa, Simon J Foster
Investigations into sigmaB-modulated regulatory pathways governing extracellular virulence determinant production in Staphylococcus aureus.
J. Bacteriol.: 2006, 188(17);6070-80
[PubMed:16923874] [WorldCat.org] [DOI] (P p)