From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01759
  • pan locus tag?: SAUPAN004255000
  • symbol: SAOUHSC_01759
  • pan gene symbol?: mreC
  • synonym:
  • product: rod shape-determining protein MreC

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01759
  • symbol: SAOUHSC_01759
  • product: rod shape-determining protein MreC
  • replicon: chromosome
  • strand: -
  • coordinates: 1660198..1661040
  • length: 843
  • essential: no [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    GTGCTTAAGTTTTTTAAAAATAACAAATTAATTGTTGTTTTATGTGCAATTATCGTTTTT
    ATTGCATTAATTGGGCTGTCCATACGTTCACAATCTCAATCACCTCCTGAACAATATATA
    GGTGATTCTGTGTCTTTTGGACAACGAGTTGTGAGTTATCCAGTTAATTTTGTTGCTGGT
    ACGATTGGGGACTTTTTTAAAAAAGGAGATTCTAAAGAATCTAAAAATAAGATTAGCCAG
    TTAGAATCTAAGAACCAACAATTAGAAGCGGAAAATGAAAAATTAAAAAAAGAGCTTGAT
    TTAAAAGATATTTCAAAATTTGATCCTATTTCTACTACGGTTTTGGCAAGAAATCCGGAT
    CAGTGGATGAATACAATTGTAATTGATAAGGGATCTAAATCAGGTATAACTTCAAATATG
    GCTGTGATGACATCACAAGGTTTTGTTGGAAGAGTTACTAAAGTTAATAAATTTTCTTCA
    CAAGTTGATTTAATCTCAACTAATACACGTGCGGGTAAATTATCTGTAAATATACAACAC
    GGTTCTAAAAATATATTTGGTTTAATTGATCGTTATGATGAAAAGAACTCAGAACTTGTA
    ATTAGTGACATTAATAATAGAGATAATATCTCAAAAGGTGATAAAGTCGTTACAAGTGGA
    TTAGCTGATCAACTACCAAGTAATTTATATATAGGAGAAGTGACTAAGGTTCAAAATGAT
    CAATACGGCTTAGCTAAAGAAGTTAGGGTTAAGACTGGTGCGGACTTAACAGATTTGAGT
    CATGTTTATGTTGCAAAAAGAGATCCTAAAACAATTCCTGATGATGAAAGCAGGGATAAA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    843

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01759
  • symbol: SAOUHSC_01759
  • description: rod shape-determining protein MreC
  • length: 280
  • theoretical pI: 9.59859
  • theoretical MW: 31010
  • GRAVY: -0.398929

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanrod shape-determining protein MreC (TIGR00219; HMM-score: 147)
    Genetic information processingMobile and extrachromosomal element functionsPlasmid functionsintegrating conjugative element protein, PFL_4705 family (TIGR03752; HMM-score: 18.1)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingpreprotein translocase, YajC subunit (TIGR00739; HMM-score: 15)
    integrating conjugative element protein, PFL_4669 family (TIGR03761; HMM-score: 12.1)
    Cellular processesCellular processesCell divisioncell division protein FtsL (TIGR02209; HMM-score: 4.9)
  • TheSEED:  
    Cell Division and Cell CycleCell Division and Cell Cycle - no subcategoryBacterial Cytoskeleton Rod shape-determining protein MreC 
    Bacterial Cell Division Rod shape-determining protein MreC 
    CBSS-354.1.peg.2917 Rod shape-determining protein MreC 
  • PFAM:
    no clan definedMreC; rod shape-determining protein MreC (PF04085; HMM-score: 135.4)
    YajC; Preprotein translocase subunit (PF02699; HMM-score: 22.5)
    TSC22; TSC-22/dip/bun family (PF01166; HMM-score: 18.7)
    FtsL (CL0225) DivIC; Septum formation initiator (PF04977; HMM-score: 17.4)
    no clan definedYabB; Initiation control protein YabA (PF06156; HMM-score: 16.6)
    IncA; IncA protein (PF04156; HMM-score: 15.4)
    OppC_N; N-terminal TM domain of oligopeptide transport permease C (PF12911; HMM-score: 15.2)
    DUF1845; Domain of unknown function (DUF1845) (PF08900; HMM-score: 15.1)
    bZIP (CL0018) bZIP_1; bZIP transcription factor (PF00170; HMM-score: 15)
    no clan definedKinetocho_Slk19; Central kinetochore-associated (PF12709; HMM-score: 14.7)
    bZIP (CL0018) bZIP_2; Basic region leucine zipper (PF07716; HMM-score: 14.5)
    no clan definedSwi5; Swi5 (PF07061; HMM-score: 12.8)
    Shugoshin_N; Shugoshin N-terminal coiled-coil region (PF07558; HMM-score: 7.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 3.33
    • Cellwall Score: 3.33
    • Extracellular Score: 3.33
    • Internal Helix: 1
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: 4
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.373
    • Ymax_pos: 33
    • Cmax: 0.221
    • Cmax_pos: 33
    • Smax: 0.77
    • Smax_pos: 27
    • Smean: 0.551
    • D: 0.442
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MLKFFKNNKLIVVLCAIIVFIALIGLSIRSQSQSPPEQYIGDSVSFGQRVVSYPVNFVAGTIGDFFKKGDSKESKNKISQLESKNQQLEAENEKLKKELDLKDISKFDPISTTVLARNPDQWMNTIVIDKGSKSGITSNMAVMTSQGFVGRVTKVNKFSSQVDLISTNTRAGKLSVNIQHGSKNIFGLIDRYDEKNSELVISDINNRDNISKGDKVVTSGLADQLPSNLYIGEVTKVQNDQYGLAKEVRVKTGADLTDLSHVYVAKRDPKTIPDDESRDK

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
    Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
    BMC Genomics: 2009, 10;291
    [PubMed:19570206] [WorldCat.org] [DOI] (I e)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]