From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_0452 [new locus tag: SAUSA300_RS02420 ]
  • pan locus tag?: SAUPAN002198000
  • symbol: dnaX
  • pan gene symbol?: dnaX
  • synonym:
  • product: DNA polymerase III subunit gamma and tau

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_0452 [new locus tag: SAUSA300_RS02420 ]
  • symbol: dnaX
  • product: DNA polymerase III subunit gamma and tau
  • replicon: chromosome
  • strand: +
  • coordinates: 509354..511027
  • length: 1674
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    ATGTACAGACCCCAAAGTTTCGAGGATGTCGTCGGACAAGAACATGTCACGAAGACATTG
    CGCAATGCGATTTCGAAAGAAAAACAGTCGCATGCTTATATTTTTAGTGGTCCGAGAGGT
    ACGGGGAAAACGAGTATTGCCAAAGTGTTTGCTAAAGCAATCAACTGTCTAAATAGCACT
    GATGGAGAACCTTGTAATGAATGTCATATTTGTAAAGGCATTACGCAGGGGACTAATTCA
    GATGTGATAGAAATTGATGCTGCTAGTAATAATGGGGTTGATGAAATAAGAAATATTAGA
    GACAAAGTTAAATATGCACCAAGTGAATCGAAATATAAAGTTTATATTATAGATGAGGTG
    CACATGCTAACAACAGGTGCTTTTAATGCCCTTTTAAAGACGTTAGAAGAACCTCCAGCA
    CACGCTATTTTTATATTGGCAACGACAGAACCACATAAAATCCCTCCAACAATCATTTCT
    AGGGCACAACGTTTTGATTTTAAAGCAATTAGCCTAGATCAAATTGTTGAACGTTTAAAA
    TTTGTAGCAGATGCACAACAAATTGAATGTGAAGATGAAGCCTTGGCATTTATCGCTAAA
    GCGTCTGAAGGGGGTATGCGTGATGCATTAAGTATTATGGATCAGGCTATTGCATTTGGT
    GATGGTACGTTAACATTGCAAGATGCGTTGAATGTCACAGGTAGCGTACATGATGAAGCG
    TTGGATCACTTGTTTGATGATATTGTACAAGGTGACGTACAAGCATCTTTTAAAAAATAC
    CATCAGTTTATAACAGAAGGTAAAGAAGTGAATCGCCTAATAAATGATATGATTTATTTT
    GTCAGAGATACGATTATGAATAAAACATCTGAGAAAGATACTGAGTATCGAGCACTGATG
    AACTTAGAATTAGATATGTTATATCAAATGATTGATCTTATTAATGATACATTAGTGTCG
    ATTCGTTTTAGTGTGAATCAAAACGTTCATTTTGAAGTGTTGTTAGTAAAATTAGCTGAG
    CAGATTAAGGGTCAACCACAAGTGATTGCGAATGTAGCTGAACCAGCACAAATTGCTTCA
    TCGCCAAACACAGATGTATTGTTGCAACGTATGGAACAGTTAGAGCAAGAACTAAAAACA
    CTAAAAGCACAAGGAGTGAGTGTCGCTCCTGTTCAAAAATCTTCGAAAAAGCCTGCGAGA
    GGCATACAAAAATCTAAAAATGCATTTTCAATGCAACAAATTGCAAAAGTGCTAGATAAA
    GCGAATAAGGCAGATATCAAATTGTTGAAAGATCATTGGCAAGAAGTGATTGATCATGCC
    AAAAATAATGATAAAAAATCACTCGTTAGTTTATTGCAAAATTCGGAACCTGTGGCGGCA
    AGTGAAGATCACGTACTTGTGAAATTTGAGGAAGAGATCCATTGTGAAATCGTCAATAAA
    GACGACGAGAAACGTAGTAGTATAGAAAGTGTTGTATGTAATATCGTTAATAAAAACGTT
    AAAGTTGTTGGTGTACCATCAGATCAATGGCAAAGAGTTCGAACGGAATATTTACAAAAT
    CGTAAAAACGAAGGCGATGATATGCCAAAGCAACAAGCACAACAAACAGATATTGCTCAA
    AAAGCAAAAGATCTTTTCGGTGAAGAAACTGTACATGTGATAGATGAAGAGTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1674

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_0452 [new locus tag: SAUSA300_RS02420 ]
  • symbol: DnaX
  • description: DNA polymerase III subunit gamma and tau
  • length: 557
  • theoretical pI: 5.24004
  • theoretical MW: 62458.4
  • GRAVY: -0.412388

Function[edit source | edit]

  • reaction:
    EC 2.7.7.7?  ExPASy
    DNA-directed DNA polymeraseDeoxynucleoside triphosphate + DNA(n) = diphosphate + DNA(n+1)
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 452.2)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, delta' subunit (TIGR00678; EC 2.7.7.7; HMM-score: 168.3)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 39.3)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 39.3)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 35.1)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 29.4)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 29.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, delta subunit (TIGR01128; EC 2.7.7.7; HMM-score: 24.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 22)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 16.4)
    Cellular processesCellular processesSporulation and germinationstage V sporulation protein K (TIGR02881; HMM-score: 15.6)
  • TheSEED:  
    DNA MetabolismDNA replicationDNA-replication DNA polymerase III subunits gamma and tau (EC 2.7.7.7) 
    DNA uptake, competenceDNA processing cluster DNA polymerase III subunits gamma and tau (EC 2.7.7.7) 
  • PFAM:
    P-loop_NTPase (CL0023) DNA_pol3_delta2; DNA polymerase III, delta subunit (PF13177; HMM-score: 161.9)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 54.2)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 32.3)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 28.6)
    post-AAA (CL0604) DNA_pol3_gamma3; DNA polymerase III subunits gamma and tau domain III (PF12169; HMM-score: 24.4)
    P-loop_NTPase (CL0023) AAA_16; AAA ATPase domain (PF13191; HMM-score: 24.3)
    AAA_30; AAA domain (PF13604; HMM-score: 22.9)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 22.5)
    AAA_19; AAA domain (PF13245; HMM-score: 20.6)
    PIF1; PIF1-like helicase (PF05970; HMM-score: 20.4)
    AAA_14; AAA domain (PF13173; HMM-score: 20.1)
    AAA_22; AAA domain (PF13401; HMM-score: 20.1)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 18.8)
    AAA_18; AAA domain (PF13238; HMM-score: 18.4)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 17.7)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 17.5)
    no clan definedAAA_assoc_2; AAA C-terminal domain (PF16193; HMM-score: 17.1)
    P-loop_NTPase (CL0023) AAA_24; AAA domain (PF13479; HMM-score: 16.9)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 14)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 12.7)
    no clan definedCom_YlbF; Control of competence regulator ComK, YlbF/YmcA (PF06133; HMM-score: 7.5)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.196
    • Ymax_pos: 54
    • Cmax: 0.17
    • Cmax_pos: 54
    • Smax: 0.312
    • Smax_pos: 51
    • Smean: 0.146
    • D: 0.177
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MYRPQSFEDVVGQEHVTKTLRNAISKEKQSHAYIFSGPRGTGKTSIAKVFAKAINCLNSTDGEPCNECHICKGITQGTNSDVIEIDAASNNGVDEIRNIRDKVKYAPSESKYKVYIIDEVHMLTTGAFNALLKTLEEPPAHAIFILATTEPHKIPPTIISRAQRFDFKAISLDQIVERLKFVADAQQIECEDEALAFIAKASEGGMRDALSIMDQAIAFGDGTLTLQDALNVTGSVHDEALDHLFDDIVQGDVQASFKKYHQFITEGKEVNRLINDMIYFVRDTIMNKTSEKDTEYRALMNLELDMLYQMIDLINDTLVSIRFSVNQNVHFEVLLVKLAEQIKGQPQVIANVAEPAQIASSPNTDVLLQRMEQLEQELKTLKAQGVSVAPVQKSSKKPARGIQKSKNAFSMQQIAKVLDKANKADIKLLKDHWQEVIDHAKNNDKKSLVSLLQNSEPVAASEDHVLVKFEEEIHCEIVNKDDEKRSSIESVVCNIVNKNVKVVGVPSDQWQRVRTEYLQNRKNEGDDMPKQQAQQTDIAQKAKDLFGEETVHVIDEE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 1.120 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]