From AureoWiki
Jump to: navigation, search

NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_0691 [new locus tag: SAUSA300_RS03710 ]
  • pan locus tag?: SAUPAN002591000
  • symbol: saeR
  • pan gene symbol?: saeR
  • synonym:
  • product: DNA-binding response regulator SaeR

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_0691 [new locus tag: SAUSA300_RS03710 ]
  • symbol: saeR
  • product: DNA-binding response regulator SaeR
  • replicon: chromosome
  • strand: -
  • coordinates: 767241..767927
  • length: 687
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGACCCACTTACTGATCGTGGATGATGAACAAGACATTGTAGACATTTGTCAAACCTAT
    TTTGAATATGAAGGTTACAAAGTAACAACGACAACTAGCGGTAAAGAAGCAATTTCTTTA
    CTATCAAATGATATTGATATCATGGTACTTGATATCATGATGCCAGAAGTTAATGGTTAC
    GACATTGTCAAAGAAATGAAAAGGCAAAAATTAGATATCCCCTTTATCTATTTAACTGCC
    AAAACACAAGAACATGATACCATTTACGCCTTAACTTTAGGTGCAGATGACTATGTCAAA
    AAACCATTTAGTCCAAGGGAACTCGTTTTACGTATTAATAATTTACTTACAAGAATGAAG
    AAATACCATCATCAACCAGTTGAACAACTGTCGTTTGATGAATTAACACTTATTAACTTA
    AGTAAAGTTGTGACTGTAAATGGTCACGAAGTCCCTATGCGTATTAAGGAATTTGAGTTA
    TTGTGGTATTTAGCTTCTAGAGAAAATGAAGTTATTTCTAAATCAGAATTACTTGAAAAA
    GTTTGGGGATATGACTATTACGAAGATGCTAATACCGTGAATGTCCATATACACCGTATT
    AGAGAAAAATTAGAAAAAGAGAGCTTTACAACATATACCATCACAACTGTATGGGGATTA
    GGATATAAATTTGAAAGGAGCCGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    687

Protein[edit source | edit]

Protein Data Bank: 4QWQ

General[edit source | edit]

  • locus tag: SAUSA300_0691 [new locus tag: SAUSA300_RS03710 ]
  • symbol: SaeR
  • description: DNA-binding response regulator SaeR
  • length: 228
  • theoretical pI: 5.0506
  • theoretical MW: 26857.6
  • GRAVY: -0.339912

Function[edit source | edit]

  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsphosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 180.9)
    Signal transductionSignal transductionTwo-component systemsphosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 180.9)
    Signal transductionRegulatory functionsDNA interactionsheavy metal response regulator (TIGR01387; HMM-score: 151.1)
    and 7 more
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 111.6)
    Cellular processesCellular processesSporulation and germinationsporulation transcription factor Spo0A (TIGR02875; HMM-score: 67.1)
    MetabolismCentral intermediary metabolismNitrogen metabolismnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transductionRegulatory functionsDNA interactionsnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transductionSignal transductionTwo-component systemsnitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transductionSignal transductionTwo-component systemsTMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 50.6)
    Signal transductionRegulatory functionsDNA interactionsPEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 28.2)
  • TheSEED:  
    Response regulator SaeR (Staphylococcus exoprotein expression protein R) 
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 101)
    HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 90.6)
    and 4 more
    CheY (CL0304) OKR_DC_1_N; Orn/Lys/Arg decarboxylase, N-terminal domain (PF03709; HMM-score: 22.7)
    EF_hand (CL0220) Caleosin; Caleosin related protein (PF05042; HMM-score: 13.4)
    no clan definedDUF2911; Protein of unknown function (DUF2911) (PF11138; HMM-score: 13.3)
    LMSTEN; LMSTEN motif (PF07988; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.099
    • Ymax_pos: 70
    • Cmax: 0.11
    • Cmax_pos: 23
    • Smax: 0.118
    • Smax_pos: 65
    • Smean: 0.071
    • D: 0.088
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTHLLIVDDEQDIVDICQTYFEYEGYKVTTTTSGKEAISLLSNDIDIMVLDIMMPEVNGYDIVKEMKRQKLDIPFIYLTAKTQEHDTIYALTLGADDYVKKPFSPRELVLRINNLLTRMKKYHHQPVEQLSFDELTLINLSKVVTVNGHEVPMRIKEFELLWYLASRENEVISKSELLEKVWGYDYYEDANTVNVHIHRIREKLEKESFTTYTITTVWGLGYKFERSR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: SaeR (activation) regulon
    SaeR(TF)important in Virulence;RegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Tobias Geiger, Christiane Goerke, Markus Mainiero, Dirk Kraus, Christiane Wolz
    The virulence regulator Sae of Staphylococcus aureus: promoter activities and response to phagocytosis-related signals.
    J. Bacteriol.: 2008, 190(10);3419-28
    [PubMed:18344360] [WorldCat.org] [DOI] (I p)
  2. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)
  3. Qian Liu, Won-Sik Yeo, Taeok Bae
    The SaeRS Two-Component System of  Staphylococcus aureus.
    Genes (Basel): 2016, 7(10);
    [PubMed:27706107] [WorldCat.org] [DOI] (P e)

Relevant publications[edit source | edit]