Due to technical reasons this service will not be available for 7 days from 27 Nov to 04 Dec 2017
From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1447 [new locus tag: SAUSA300_RS07900 ]
  • pan locus tag?: SAUPAN004030000
  • symbol: xerD
  • pan gene symbol?: xerD
  • synonym:
  • product: tyrosine recombinase XerD

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_1447 [new locus tag: SAUSA300_RS07900 ]
  • symbol: xerD
  • product: tyrosine recombinase XerD
  • replicon: chromosome
  • strand: -
  • coordinates: 1600436..1601323
  • length: 888
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGGAAACAATTATTGAAGAATATTTGCGTTTTATACAAATTGAAAAAGGACTAAGTTCT
    AACACAATTGGTGCTTATAGACGTGATTTGAAAAAGTATCAAGATTATATGACTGAACAT
    CATATCTCGCATATTGATTTTATAGATCGACAATTAATTCAAGAGTGTTTGGGGCATTTA
    ATAGACCAAGGGCAATCTGCTAAATCTATTGCGCGATTTATTTCAACAATCCGTAGTTTT
    CATCAATTTGCTATAAGAGAAAAATATGCGGCGAAAGATCCAACGGTATTATTAGATTCA
    CCAAAATATGACAAAAAATTGCCTGACGTTTTAAATGTTGACGAAGTGTTGGCTTTATTA
    GAAACGCCAGATTTAAATAAAATTAATGGATATCGTGATCGTACGATGTTAGAACTTCTG
    TACGCAACGGGAATGCGTGTATCTGAATTGATACATTTAGAGTTAGAAAACGTGAACTTA
    ATAATGGGATTTGTACGCGTATTTGGTAAAGGCGATAAAGAAAGAATTGTACCATTAGGC
    GACGCAGTCATTGAGTACTTAACTACTTATATTGAAACGATTAGACCGCAACTTTTAAAA
    AAGACTGTTACTGAAGTCTTATTTTTAAATATGCATGGTAAACCTTTATCACGACAAGCA
    ATATGGAAAATGATTAAACAAAATGGTGTAAAGGCAAACATTAAAAAGACGTTAACGCCA
    CATACGTTACGCCACTCTTTTGCGACACATTTATTGGAAAATGGCGCAGATTTAAGAGCA
    GTGCAAGAGATGTTAGGTCACTCTGACATATCTACTACCCAACTCTATACACATGTTTCG
    AAATCTCAAATTAGAAAAATGTATAACCAATTTCATCCTAGAGCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    888

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_1447 [new locus tag: SAUSA300_RS07900 ]
  • symbol: XerD
  • description: tyrosine recombinase XerD
  • length: 295
  • theoretical pI: 9.46286
  • theoretical MW: 34132.3
  • GRAVY: -0.316271

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairtyrosine recombinase XerD (TIGR02225; HMM-score: 396.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairtyrosine recombinase XerC (TIGR02224; HMM-score: 332.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairintegron integrase (TIGR02249; HMM-score: 154)
    Genetic information processingMobile and extrachromosomal element functionsOtherintegron integrase (TIGR02249; HMM-score: 154)
  • TheSEED:  
    Site-specific tyrosine recombinase XerD 
  • PFAM:
    DNA-mend (CL0382) Phage_integrase; Phage integrase family (PF00589; HMM-score: 176)
    l-integrase_N (CL0469) Phage_int_SAM_1; Phage integrase, N-terminal SAM-like domain (PF02899; HMM-score: 92.4)
    Phage_int_SAM_5; Phage integrase SAM-like domain (PF13102; HMM-score: 28.2)
    Phage_int_SAM_4; Phage integrase, N-terminal SAM-like domain (PF13495; HMM-score: 24.7)
    HTH (CL0123) Linker_histone; linker histone H1 and H5 family (PF00538; HMM-score: 12.6)
    PepSY (CL0320) DUF3192; Protein of unknown function (DUF3192) (PF11399; HMM-score: 12.5)
    HTH (CL0123) HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.104
    • Ymax_pos: 28
    • Cmax: 0.147
    • Cmax_pos: 28
    • Smax: 0.109
    • Smax_pos: 64
    • Smean: 0.067
    • D: 0.09
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • METIIEEYLRFIQIEKGLSSNTIGAYRRDLKKYQDYMTEHHISHIDFIDRQLIQECLGHLIDQGQSAKSIARFISTIRSFHQFAIREKYAAKDPTVLLDSPKYDKKLPDVLNVDEVLALLETPDLNKINGYRDRTMLELLYATGMRVSELIHLELENVNLIMGFVRVFGKGDKERIVPLGDAVIEYLTTYIETIRPQLLKKTVTEVLFLNMHGKPLSRQAIWKMIKQNGVKANIKKTLTPHTLRHSFATHLLENGADLRAVQEMLGHSDISTTQLYTHVSKSQIRKMYNQFHPRA

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]