From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_2566 [new locus tag: SAUSA300_RS14275 ]
  • pan locus tag?: SAUPAN006359000
  • symbol: arcR
  • pan gene symbol?: arcR
  • synonym:
  • product: Crp/FNR family transcriptional regulator

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_2566 [new locus tag: SAUSA300_RS14275 ]
  • symbol: arcR
  • product: Crp/FNR family transcriptional regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 2777389..2778093
  • length: 705
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGACAGAAAACTTTATTTTGGGTAGAAATAATAAATTAGAACATGAACTAAAGGCATTA
    GCAGATTACATTAATATACCATATAGTATATTACAACCATATCAAAGTGAATGTTTTGTC
    AGACATTATACGAAAGGCCAAGTTATTTATTTTTCGCCACAAGAAAGTAGCAATATTTAC
    TTTTTAATTGAAGGTAACATTATTAGAGAACATTACAATCAAAATGGAGATGTATATCGT
    TATTTTAATAAAGAGCAAGTATTATTTCCAATCAGTAACTTATTTCATCCGAAAGAGGTT
    AACGAATTGTGTACAGCATTAACCGATTGTACAGTTCTTGGATTGCCTAGAGAATTGATG
    GCCTTTTTGTGCAAAGCTAATGATGATATATTTTTGACACTTTTTGCATTAATAAATGAT
    AATGAGCAGCAACACATGAACTATAACATGGCATTAACAAGTAAATTTGCTAAAGATCGA
    ATTATCAAATTGATATGCCATCTATGTCAGACAGTAGGATACGATCAAGATGAATTTTAT
    GAAATCAAACAGTTTTTAACTATTCAACTCATGAGTGATATGGCTGGGATTTCCCGGGAA
    ACAGCTGGTCATATTATTCATGAACTTAAAGATGAAAAACTTGTTGTTAAAGATCATAAA
    AATTGGTTAGTAAGCAAACATTTATTCAATGATGTATGTGTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    705

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_2566 [new locus tag: SAUSA300_RS14275 ]
  • symbol: ArcR
  • description: Crp/FNR family transcriptional regulator
  • length: 234
  • theoretical pI: 5.97765
  • theoretical MW: 27428.3
  • GRAVY: -0.217949

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Signal transductionRegulatory functionsDNA interactionsglobal nitrogen regulator NtcA (TIGR03697; HMM-score: 26.3)
  • TheSEED:  
    Amino Acids and DerivativesArginine; urea cycle, polyaminesArginine and Ornithine Degradation Transcriptional regulator ArcR essential for anaerobic expression of the ADI pathway, Crp/Fnr family 
    Arginine; urea cycle, polyaminesArginine Deiminase Pathway Transcriptional regulator ArcR essential for anaerobic expression of the ADI pathway, Crp/Fnr family 
  • PFAM:
    HTH (CL0123) HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 29.6)
    Cupin (CL0029) cNMP_binding; Cyclic nucleotide-binding domain (PF00027; HMM-score: 28.3)
    no clan definedCatalase-rel; Catalase-related immune-responsive (PF06628; HMM-score: 13.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.109
    • Ymax_pos: 22
    • Cmax: 0.11
    • Cmax_pos: 22
    • Smax: 0.152
    • Smax_pos: 41
    • Smean: 0.105
    • D: 0.108
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTENFILGRNNKLEHELKALADYINIPYSILQPYQSECFVRHYTKGQVIYFSPQESSNIYFLIEGNIIREHYNQNGDVYRYFNKEQVLFPISNLFHPKEVNELCTALTDCTVLGLPRELMAFLCKANDDIFLTLFALINDNEQQHMNYNMALTSKFAKDRIIKLICHLCQTVGYDQDEFYEIKQFLTIQLMSDMAGISRETAGHIIHELKDEKLVVKDHKNWLVSKHLFNDVCV

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: ArcR, ArgR, CcpA, Rex
    ArcR (TF) important in Arginine degradation  RegPrecise    transcription unit transferred from N315 data RegPrecise
    ArgR (TF) important in Arginine biosynthesis, Arginine degradation  RegPrecise    transcription unit transferred from N315 data RegPrecise
    CcpA (TF) important in Carbon catabolism  RegPrecise    transcription unit transferred from N315 data RegPrecise
    Rex (TF) important in Energy metabolism  RegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]