From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS07440 [old locus tag: SAUSA300_1364 ]
  • pan locus tag?: SAUPAN003936000
  • symbol: SAUSA300_RS07440
  • pan gene symbol?: engA
  • synonym:
  • product: ribosome biogenesis GTPase Der

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_RS07440 [old locus tag: SAUSA300_1364 ]
  • symbol: SAUSA300_RS07440
  • product: ribosome biogenesis GTPase Der
  • replicon: chromosome
  • strand: -
  • coordinates: 1530440..1531750
  • length: 1311
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_007793 (1530440..1531750) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGACTAAACCTATAGTAGCTATTGTAGGTAGGCCTAATGTAGGTAAATCTACAATTTTT
    AATAGAATAGTTGGAGAACGTGTTTCGATTGTGGAAGACACGCCAGGTGTAACACGAGAT
    CGTATTTATTCTTCAGGTGAATGGTTAACACATGATTTCAATATTATTGATACAGGTGGT
    ATTGAAATTGGTGATGCACCATTCCAAACACAAATTAGAGCGCAGGCAGAAATCGCCATA
    GATGAAGCGTATGTTATTATTTTTATGGTTAACGTGCGTGAAGGATTGACACAAAGCGAT
    GAAATGGTCGCTCAAATTTTATACAAATCTAAAAAACCGGTCGTATTAGCGGTTAACAAA
    GTAGATAATATGGAAATGCGTACAGACGTGTATGATTTCTATTCATTAGGATTTGGTGAA
    CCGTATCCGATATCAGGGTCACATGGTTTAGGTCTTGGTGACTTGTTAGATGCAGTTGTT
    TCTCATTTTGGTGAAGAGGAAGAAGATCCTTATGATGAAGATACAATTCGACTATCCATT
    ATTGGACGACCAAACGTAGGTAAATCAAGTTTAGTAAATGCTATTTTAGGTGAAGATCGC
    GTTATCGTTTCTAATGTTGCAGGGACAACGAGAGACGCTATTGATACAGAGTATAGTTAT
    GATGGACAAGATTATGTTTTAATCGATACTGCTGGTATGCGTAAAAAAGGAAAAGTATAT
    GAATCAACTGAGAAATATTCAGTATTAAGAGCTTTAAAAGCGATTGAACGTTCAAATGTT
    GTTTTAGTGGTCATAGATGCAGAACAAGGCATCATTGAACAAGATAAACGTGTTGCAGGA
    TATGCACATGAACAAGGTAAAGCAGTCGTGATTGTCGTAAATAAATGGGATACTGTGGAA
    AAAGATAGTAAAACGATGAAGAAATTTGAAGATGAAGTACGTAAAGAATTCCAATTTTTA
    GATTATGCACAAATTGCTTTTGTGTCTGCTAAAGAACGCACAAGATTACGTACATTATTC
    CCTTACATCAATGAAGCAAGTGAAAACCATAAAAAACGTGTTCAAAGTTCAACTTTAAAT
    GAAGTTGTTACTGGTGCAATTTCCATGAACCCTACACCAACAGACAAAGGTAGACGTTTG
    AATGTCTTTTATGCAACACAAGTTGCTATAGAACCACCGACATTTGTTGTATTTGTTAAT
    GATGTAGAATTAATGCATTTTTCTTATAAACGCTATTTAGAGAATCAAATCCGTGCCGCT
    TTTGGTTTTGAAGGTACACCAATTCATATTATAGCTCGAAAGAGAAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1311

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_RS07440 [old locus tag: SAUSA300_1364 ]
  • symbol: SAUSA300_RS07440
  • description: ribosome biogenesis GTPase Der
  • length: 436
  • theoretical pI: 5.16352
  • theoretical MW: 48969.2
  • GRAVY: -0.259633

Function[edit source | edit]

  • reaction:
    EC 1.1.1.95?  ExPASy
    Phosphoglycerate dehydrogenase3-phospho-D-glycerate + NAD+ = 3-phosphonooxypyruvate + NADH2-hydroxyglutarate + NAD+ = 2-oxoglutarate + NADH
  • TIGRFAM:
    Genetic information processingProtein synthesisOtherribosome-associated GTPase EngA (TIGR03594; HMM-score: 600.3)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 179.5)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 170.6)
    Genetic information processingProtein synthesisOtherGTP-binding protein Era (TIGR00436; HMM-score: 163)
    Genetic information processingProtein fateProtein modification and repair[FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 148.7)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 105.6)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 100)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsferrous iron transport protein B (TIGR00437; HMM-score: 87.6)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 66.5)
    Unknown functionGeneralGTP-binding protein HflX (TIGR03156; HMM-score: 57.5)
    Genetic information processingProtein synthesisOtherObg family GTPase CgtA (TIGR02729; HMM-score: 43.3)
    Genetic information processingProtein synthesisTranslation factorsribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 39.4)
    MetabolismTransport and binding proteinsNucleosides, purines and pyrimidinesGTP-binding protein (TIGR00991; HMM-score: 36)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfate adenylyltransferase, large subunit (TIGR02034; EC 2.7.7.4; HMM-score: 33.2)
    Genetic information processingProtein synthesisTranslation factorstranslation initiation factor IF-2 (TIGR00487; HMM-score: 31.1)
    Cellular processesCellular processesAdaptations to atypical conditionsGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 30.5)
    Genetic information processingProtein synthesisTranslation factorsGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 30.5)
    Signal transductionRegulatory functionsOtherGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 30.5)
    Unknown functionGeneralGTP-binding protein YchF (TIGR00092; HMM-score: 27.7)
    Unknown functionGeneralelongation factor 4 (TIGR01393; EC 3.6.5.-; HMM-score: 25.6)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsguanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 24.5)
    MetabolismTransport and binding proteinsAmino acids, peptides and amineschloroplast protein import component Toc86/159, G and M domains (TIGR00993; HMM-score: 23.5)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 17)
    Genetic information processingProtein synthesisTranslation factorstranslation initiation factor aIF-2 (TIGR00491; HMM-score: 16.3)
    MetabolismEnergy metabolismAmino acids and aminesethanolamine utilization protein, EutP (TIGR02528; HMM-score: 15.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme Adephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 13.3)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 12.9)
    Signal transductionRegulatory functionsProtein interactionsLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 12.9)
    Genetic information processingProtein fateProtein modification and repairhydrogenase accessory protein HypB (TIGR00073; HMM-score: 12.5)
    translation initiation factor 2, gamma subunit (TIGR03680; HMM-score: 11.4)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 182.4)
    no clan definedKH_dom-like; KH-domain-like of EngA bacterial GTPase enzymes, C-terminal (PF14714; HMM-score: 111.5)
    P-loop_NTPase (CL0023) FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 100.2)
    GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 76.2)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 53.4)
    AIG1; AIG1 family (PF04548; HMM-score: 53.3)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 39.9)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 35.6)
    Ras; Ras family (PF00071; HMM-score: 33.6)
    ABC_tran; ABC transporter (PF00005; HMM-score: 26.8)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 23.2)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 21.5)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 20.3)
    Nribosyltransf (CL0498) Nuc_deoxyrib_tr; Nucleoside 2-deoxyribosyltransferase (PF05014; HMM-score: 19.1)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 18.5)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 17.6)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 16.6)
    AAA_24; AAA domain (PF13479; HMM-score: 16.4)
    Nribosyltransf (CL0498) Nuc_deoxyri_tr2; Nucleoside 2-deoxyribosyltransferase like (PF15891; HMM-score: 15.7)
    P-loop_NTPase (CL0023) AAA_16; AAA ATPase domain (PF13191; HMM-score: 15.6)
    AAA_18; AAA domain (PF13238; HMM-score: 15.5)
    AAA_22; AAA domain (PF13401; HMM-score: 15.2)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 15.1)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 14.5)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 14.5)
    NTPase_1; NTPase (PF03266; HMM-score: 13.9)
    no clan definedDUF1995; Domain of unknown function (DUF1995) (PF09353; HMM-score: 12.7)
    P-loop_NTPase (CL0023) AAA_15; AAA ATPase domain (PF13175; HMM-score: 12.4)
    AAA_14; AAA domain (PF13173; HMM-score: 12)
    HAD (CL0137) PNK3P; Polynucleotide kinase 3 phosphatase (PF08645; HMM-score: 9.1)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.138
    • Ymax_pos: 11
    • Cmax: 0.107
    • Cmax_pos: 17
    • Smax: 0.245
    • Smax_pos: 7
    • Smean: 0.191
    • D: 0.159
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446087681 NCBI
  • RefSeq: WP_000165536 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTKPIVAIVGRPNVGKSTIFNRIVGERVSIVEDTPGVTRDRIYSSGEWLTHDFNIIDTGGIEIGDAPFQTQIRAQAEIAIDEAYVIIFMVNVREGLTQSDEMVAQILYKSKKPVVLAVNKVDNMEMRTDVYDFYSLGFGEPYPISGSHGLGLGDLLDAVVSHFGEEEEDPYDEDTIRLSIIGRPNVGKSSLVNAILGEDRVIVSNVAGTTRDAIDTEYSYDGQDYVLIDTAGMRKKGKVYESTEKYSVLRALKAIERSNVVLVVIDAEQGIIEQDKRVAGYAHEQGKAVVIVVNKWDTVEKDSKTMKKFEDEVRKEFQFLDYAQIAFVSAKERTRLRTLFPYINEASENHKKRVQSSTLNEVVTGAISMNPTPTDKGRRLNVFYATQVAIEPPTFVVFVNDVELMHFSYKRYLENQIRAAFGFEGTPIHIIARKRN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAUSA300_RS07440 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]