From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS07755 [old locus tag: SAUSA300_1421 ]
  • pan locus tag?: SAUPAN001452000
  • symbol: SAUSA300_RS07755
  • pan gene symbol?:
  • synonym:
  • product: PVL family protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_RS07755 [old locus tag: SAUSA300_1421 ]
  • symbol: SAUSA300_RS07755
  • product: PVL family protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1580799..1581200
  • length: 402
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_007793 (1580799..1581200) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    ATGGCTAGAAGAAAAGTTATAAGAGTGCGTATCAAAGGAAAACTAATGACATTGAGAGAA
    GTTTCAGAAAAATATCATATATCTCCAGAACTTCTTAGATACAGATACAAACATAAAATG
    CGCGGCGATGAATTATTGTGTGGAAGAAAAGACTCAAAATCTAAAGATGAAGTTGAATAT
    ATGAAGAGTCAAATAAAAGATGAAGAAAAAGAGAGAGAAAAAATCAGAAAAAAAGCGATT
    TTGAACCTATACCAACGAAATGTGAGAGCGGAATATGAAGAAGAAAGAAAGAGAAGATTG
    AGACCATGGCTTTATGATGGAACGCCTCAAAAACATTCACGTGATCCGTACTGGTTCGAT
    GTCACTTATAACCAAATGTTCAAGAAATGGAGTGAAGCATAA
    60
    120
    180
    240
    300
    360
    402

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_RS07755 [old locus tag: SAUSA300_1421 ]
  • symbol: SAUSA300_RS07755
  • description: PVL family protein
  • length: 133
  • theoretical pI: 10.5044
  • theoretical MW: 16573.1
  • GRAVY: -1.36316

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:
    no clan definedPVL_ORF50; PVL ORF-50-like family (PF07768; HMM-score: 180.1)
    HTH (CL0123) Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 14.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.24
    • Ymax_pos: 11
    • Cmax: 0.12
    • Cmax_pos: 25
    • Smax: 0.695
    • Smax_pos: 1
    • Smean: 0.551
    • D: 0.361
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446036119 NCBI
  • RefSeq: WP_000113974 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MARRKVIRVRIKGKLMTLREVSEKYHISPELLRYRYKHKMRGDELLCGRKDSKSKDEVEYMKSQIKDEEKEREKIRKKAILNLYQRNVRAEYEEERKRRLRPWLYDGTPQKHSRDPYWFDVTYNQMFKKWSEA

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAUSA300_RS07755 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]