Due to technical reasons this service will not be available for 7 days from 27 Nov to 04 Dec 2017
From AureoWiki
Jump to: navigation, search
Pangenome04-0298108BA0217611819-9771193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS07770 [old locus tag: SAUSA300_1424 ]
  • pan locus tag?: SAUPAN001438000
  • symbol: SAUSA300_RS07770
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAUSA300_RS07770 [old locus tag: SAUSA300_1424 ]
  • symbol: SAUSA300_RS07770
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1583418..1583975
  • length: 558
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_007793 (1583418..1583975) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGAAAGCAAAAGTATTAAATAAAACTAAAGTGATTACAGGAAAAGTAAGAGCATCATAT
    GCACATATTTTTGAACCTCACAGTATGCAAGAAGGGCAAGAATCAAAGTATTCAATCAGT
    TTAATCATTCCTAAATCAGATACAAGTACGATAAAAGCCATTGAACAAGCTATAGAAGCT
    GCTAAAGAAGAAGGAAAAGTTAGTAAGTTTGGAGGCAAAGTTCCTGCAAATCTGAAACTT
    CCATTACGTGATGGAGATACTGAAAGAGAAGATGATGTCAATTATCAAGACGCTTATTTT
    ATTAACGCATCAAGCAAACAAGCACCTGGTATTATTGACCAAAACAAAATTAGATTAACG
    GATTCTGGAACTGTTGTAAGTGGTGATTATATTAGAGCTTCAATTAATCTATTTCCTTTC
    AACACAAATGGTAATAAGGGTATCGCAGTTGGATTGAACAACATTCAACTTGTAGAAAAA
    GGCGAACCTCTTGGCGGTGCAAGTGCAGCAGAAGATGATTTCGATGAATTAGACACTGAT
    GATGAGGATTTCTTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    558

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAUSA300_RS07770 [old locus tag: SAUSA300_1424 ]
  • symbol: SAUSA300_RS07770
  • description: hypothetical protein
  • length: 185
  • theoretical pI: 4.6081
  • theoretical MW: 20123.3
  • GRAVY: -0.500541

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateProtein and peptide secretion and traffickingputative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 10)
    Signal transductionSignal transductionTwo-component systemsputative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 10)
  • TheSEED:
  • PFAM:
    no clan definedDUF2815; Protein of unknown function (DUF2815) (PF10991; HMM-score: 232.5)
    DUF320; Small secreted domain (DUF320) (PF03777; HMM-score: 12.3)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.78
    • Cytoplasmic Membrane Score: 8.16
    • Cellwall Score: 0.06
    • Extracellular Score: 0.01
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.218
    • Ymax_pos: 12
    • Cmax: 0.125
    • Cmax_pos: 33
    • Smax: 0.54
    • Smax_pos: 2
    • Smean: 0.466
    • D: 0.315
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446567702 NCBI
  • RefSeq: WP_000645048 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKAKVLNKTKVITGKVRASYAHIFEPHSMQEGQESKYSISLIIPKSDTSTIKAIEQAIEAAKEEGKVSKFGGKVPANLKLPLRDGDTEREDDVNYQDAYFINASSKQAPGIIDQNKIRLTDSGTVVSGDYIRASINLFPFNTNGNKGIAVGLNNIQLVEKGEPLGGASAAEDDFDELDTDDEDFL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SAUSA300_RS07770 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]