From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

⊟Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS09505 [old locus tag: SAtRNA33 ]
  • pan locus tag?: SAUPAN004805000
  • symbol: SA_RS09505
  • pan gene symbol?: trnaW
  • synonym:
  • product: tRNA-Trp

⊟Genome View[edit source | edit]

⊟Gene[edit source | edit]

⊟General[edit source | edit]

  • type: tRNA
  • locus tag: SA_RS09505 [old locus tag: SAtRNA33 ]
  • symbol: SA_RS09505
  • product: tRNA-Trp
  • replicon: chromosome
  • strand: -
  • coordinates: 1916909..1916982
  • length: 74
  • essential: unknown

⊟Accession numbers[edit source | edit]

  • Location: NC_002745 (1916909..1916982) NCBI
  • MicrobesOnline:

⊟Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit source | edit]

  • 1
    61
    AGGGGCATAGTTCAACGGTAGAATAGAGGTCTCCAAAACCTTTGGTGTGGGTTCGATTCC
    TACTGCCCCTGCCA
    60
    74

⊟Protein[edit source | edit]

⊟General[edit source | edit]

  • locus tag: SA_RS09505 [old locus tag: SAtRNA33 ]
  • symbol: SA_RS09505
  • description: tRNA-Trp
  • length: 0
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

⊟Function[edit source | edit]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

⊟Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

⊟Localization[edit source | edit]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

⊟Accession numbers[edit source | edit]

  • GI:
  • RefSeq:
  • UniProt:

⊟Protein sequence[edit source | edit]

⊟Experimental data[edit source | edit]

  • experimentally validated: no data available

⊟Expression & Regulation[edit source | edit]

⊟Operon[edit source | edit]

  • SA_RS09505 no polycistronic organisation predicted

⊟Regulation[edit source | edit]

  • sigma factor:
  • regulator:

⊟Transcription pattern[edit source | edit]

⊟Protein synthesis (provided by Aureolib)[edit source | edit]

⊟Protein stability[edit source | edit]

  • half-life: no data available

⊟Biological Material[edit source | edit]

⊟Mutants[edit source | edit]

⊟Expression vector[edit source | edit]

⊟lacZ fusion[edit source | edit]

⊟GFP fusion[edit source | edit]

⊟two-hybrid system[edit source | edit]

⊟FLAG-tag construct[edit source | edit]

⊟Antibody[edit source | edit]

⊟Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

⊟Literature[edit source | edit]

⊟References[edit source | edit]

⊟Relevant publications[edit source | edit]

Retrieved from "https://aureowiki.med.uni-greifswald.de/index.php?title=SA_RS09505&oldid=84626"