From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS12375 [old locus tag: SA2155 ]
  • pan locus tag?: SAUPAN005877000
  • symbol: SA_RS12375
  • pan gene symbol?: mqo1
  • synonym:
  • product: malate:quinone oxidoreductase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS12375 [old locus tag: SA2155 ]
  • symbol: SA_RS12375
  • product: malate:quinone oxidoreductase
  • replicon: chromosome
  • strand: -
  • coordinates: 2420078..2421556
  • length: 1479
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (2420078..2421556) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    ATGACAACACAACATAGCAAAACAGATGTCATCTTAATTGGTGGCGGTATTATGAGTGCA
    ACATTAGGAACATTACTTAAAGAATTATCACCTGAGAAAAATATTAAAGTGTTTGAAAAA
    TTAGCACAACCTGGCGAAGAGAGTTCAAATGTATGGAATAATGCCGGTACAGGGCATTCA
    GCACTTTGCGAGTTGAACTATACAAAAGAAGGTAAGGATGGCACAGTTGATTGTAGTAAA
    GCAATTAAGATAAATGAGCAGTACCAAATTTCAAAACAGTTTTGGGCATATTTAGTTAAA
    ACAGGACAATTAGATAACCCAGATCGCTTTATTCAAGCGGTGCCACACATGAGTTTTGTC
    ATTGGCGAAGATAATGTAGCTTTTATAAAAAGTCGTGTTGCAACGTTAAAGAAAAGTGTT
    TTATTCGAAAAAATGAAATTATCGCAAGATGAAGAAGAAATGAAATCTTGGGTACCGTTA
    ATGATTGAAGGTCGTAAGTCTGATGAACCAATTGCTTTAACTTATGATGAAACTGGTACA
    GATGTTAACTTTGGTGCGTTAACTGCAAAGTTATTTGAAAATTTAGAGCAACGTGGTGTG
    GGAATTCAATATAAGCAGAATGTATTAGACATCAAGAAACAGAAATCTGGGGCATGGCTA
    GTTAAAGTTAAAGATTTAGAAACTAATGAAACGACAACATATGAATCTGATTTTGTATTT
    ATTGGTGCTGGCGGTGCGAGTTTACCATTACTCCAAAAGACTGGGATTAAACAATCAAAA
    CATATTGGTGGTTTCCCAGTAAGTGGATTATTCCTGCGCTGTACAAATCAAGAAGTGATT
    GATCGTCATCATGCTAAAGTGTACGGAAAAGCAGCAGTGGGTGCGCCACCAATGTCAGTG
    CCGCACTTAGATACACGTTTTGTAGACGGCAAGCGTTCATTGTTATTTGGTCCATTTGCA
    GGTTTCTCACCTAAATTTTTAAAAACAGGTTCACATATGGATTTAATTAAATCGGTTAAA
    CCAAATAATATCGTGACGATGTTATCTGCAGGTATCAAAGAAATGAGTCTTACGAAGTAT
    TTAGTGTCACAATTGATGTTATCTAATGATGAGCGTATGGATGATTTAAGAGTCTTTTTC
    CCAAATGCTAAAAATGAAGATTGGGAAGTGATTACAGCAGGGCAACGTGTCCAAGTAATC
    AAGGATACTGAGGATTCTAAAGGTAACTTACAATTTGGTACCGAAGTCATTACGTCAGAT
    GATGGCACATTAGCTGCATTACTTGGTGCATCACCTGGTGCGTCAACAGCTGTAGATATT
    ATGTTTGATGTTTTACAGCGATGCTATCGTGATGAATTCAAAGGGTGGGAACCAAAGATT
    AAAGAAATGGTGCCGTCATTTGGTTATCGCTTAACAGATCATGAGGATTTATATCACAAA
    ATTAATGAAGAAGTAACTAAGTATTTACAAGTTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1479

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS12375 [old locus tag: SA2155 ]
  • symbol: SA_RS12375
  • description: malate:quinone oxidoreductase
  • length: 492
  • theoretical pI: 6.68641
  • theoretical MW: 54785.3
  • GRAVY: -0.327236

Function[edit source | edit]

  • reaction:
    EC 1.1.5.4?  ExPASy
    Malate dehydrogenase (quinone)(S)-malate + a quinone = oxaloacetate + reduced quinone
  • TIGRFAM:
    MetabolismEnergy metabolismTCA cyclemalate dehydrogenase (acceptor) (TIGR01320; EC 1.1.5.4; HMM-score: 711)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 17.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 16.7)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 15.4)
    Cellular processesCellular processesDetoxificationCoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 11.1)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Mqo; Malate:quinone oxidoreductase (Mqo) (PF06039; HMM-score: 770.4)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 35.9)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 17.1)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 16.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS0021550S ribosomal protein L9  [1] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SA_RS02710cysteine synthase  [1] (data from MRSA252)
    SA_RS0290550S ribosomal protein L11  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS04145phosphoglycerate kinase  [1] (data from MRSA252)
    SA_RS04150triose-phosphate isomerase  [1] (data from MRSA252)
    SA_RS04160enolase  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    SA_RS05620thiol reductase thioredoxin  [1] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [1] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06235elongation factor Ts  [1] (data from MRSA252)
    SA_RS06490glutamine synthetase  [1] (data from MRSA252)
    SA_RS06730aconitate hydratase  [1] (data from MRSA252)
    SA_RS070652-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [1] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [1] (data from MRSA252)
    SA_RS08760formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA_RS11245glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1163050S ribosomal protein L17  [1] (data from MRSA252)
    SA_RS1164030S ribosomal protein S11  [1] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [1] (data from MRSA252)
    SA_RS1169530S ribosomal protein S8  [1] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [1] (data from MRSA252)
    SA_RS1172030S ribosomal protein S17  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS13420L-glutamate gamma-semialdehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 0.53
    • Cellwall Score: 8.75
    • Extracellular Score: 0.7
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.203
    • Ymax_pos: 38
    • Cmax: 0.173
    • Cmax_pos: 38
    • Smax: 0.314
    • Smax_pos: 19
    • Smean: 0.233
    • D: 0.215
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446133511 NCBI
  • RefSeq: WP_000211366 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTTQHSKTDVILIGGGIMSATLGTLLKELSPEKNIKVFEKLAQPGEESSNVWNNAGTGHSALCELNYTKEGKDGTVDCSKAIKINEQYQISKQFWAYLVKTGQLDNPDRFIQAVPHMSFVIGEDNVAFIKSRVATLKKSVLFEKMKLSQDEEEMKSWVPLMIEGRKSDEPIALTYDETGTDVNFGALTAKLFENLEQRGVGIQYKQNVLDIKKQKSGAWLVKVKDLETNETTTYESDFVFIGAGGASLPLLQKTGIKQSKHIGGFPVSGLFLRCTNQEVIDRHHAKVYGKAAVGAPPMSVPHLDTRFVDGKRSLLFGPFAGFSPKFLKTGSHMDLIKSVKPNNIVTMLSAGIKEMSLTKYLVSQLMLSNDERMDDLRVFFPNAKNEDWEVITAGQRVQVIKDTEDSKGNLQFGTEVITSDDGTLAALLGASPGASTAVDIMFDVLQRCYRDEFKGWEPKIKEMVPSFGYRLTDHEDLYHKINEEVTKYLQVK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS12375 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]