From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS13260 [old locus tag: SA2313 ]
  • pan locus tag?: SAUPAN006174000
  • symbol: SA_RS13260
  • pan gene symbol?:
  • synonym:
  • product: haloacid dehalogenase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS13260 [old locus tag: SA2313 ]
  • symbol: SA_RS13260
  • product: haloacid dehalogenase
  • replicon: chromosome
  • strand: -
  • coordinates: 2598232..2599032
  • length: 801
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (2598232..2599032) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGTTAAGGCTATTGCGGTAGATATGGACGGGACGTTTTTAGATTCGAAAAAGACATAC
    GATAAACCGAGATTTGAAGCGATTTTTACTGAACTTAGAAATAGAGATATTACATTTATT
    GCTGCGAGTGGCAATCAATATGCGAAGTTGAAGTCTATTTTCGGGGATAGAGATATGTAT
    TTTATTTCTGAAAATGGTGCAGTTATTTATAAAGGCAATGAGTTATATAATTATAAAAGC
    TTTAATCGTCAGGTGTTTCAACAGGTCGTCGATTACTTAAATATGAACCAAAGTATTGAT
    CAACTCGTCATCTGTGGTTTGAAAAGCGCGTATATTTTAAAACATACTTCTGAAGCATTT
    AAAGAAGATACGAGATTTTATTATCATCAGTTAAAAGAAATTGACAGTCTACAACAATTA
    CCTGAGGATGATTATGTCAAAATAGCATTTAATATTAATCGTGAGACGCATCCAAATGTT
    GACGAAGAAGTAGCAACGCAATTCAGCAATGATATTAAACTTGTCTCAAGTGGGCACGAT
    AGCATTGATATTATTATGCCAAACATGACTAAAGGGCAGGCATTAAAACGATTGTTAGAT
    AAATGGGAAATGTCTCCTTCAGAGCTCATGGCCTTTGGAGATGCGAATAATGATAAAGAT
    ATGCTAGCGTTCGCTAAGCATAGTTATGTGATGGAAAATAGTCATGATGAAGAATTGTTC
    AATATTGCCTCGGCTGTCGCTCCAAGTAATGATAAGCAGGGTGTTTTAACGATTATCGAA
    CAAGAAGTATTGAACAAGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    801

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS13260 [old locus tag: SA2313 ]
  • symbol: SA_RS13260
  • description: haloacid dehalogenase
  • length: 266
  • theoretical pI: 4.75816
  • theoretical MW: 30536.3
  • GRAVY: -0.444361

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Unknown functionEnzymes of unknown specificityCof-like hydrolase (TIGR00099; HMM-score: 168.1)
    Unknown functionEnzymes of unknown specificityHAD hydrolase, family IIB (TIGR01484; HMM-score: 81.5)
    sucrose-phosphate phosphatase subfamily (TIGR01482; EC 3.1.3.-; HMM-score: 66.6)
    phosphoglycolate phosphatase, TA0175-type (TIGR01487; EC 3.1.3.18; HMM-score: 62.9)
    sucrose phosphatase (TIGR01485; EC 3.1.3.24; HMM-score: 48.7)
    mannosyl-3-phosphoglycerate phosphatase family (TIGR01486; EC 3.1.3.-; HMM-score: 37.5)
    mannosyl-3-phosphoglycerate phosphatase (TIGR02461; EC 3.1.3.70; HMM-score: 37.3)
    sucrose-phosphate synthase, sucrose phosphatase-like domain (TIGR02471; HMM-score: 36.6)
    Unknown functionGeneralmannosyl-3-phosphoglycerate phosphatase homolog (TIGR02463; EC 3.1.3.-; HMM-score: 32.4)
    Unknown functionEnzymes of unknown specificityHAD hydrolase, family IB (TIGR01490; HMM-score: 19.8)
    phosphoserine phosphatase-like hydrolase, archaeal (TIGR01491; HMM-score: 18.6)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairrecombination protein rad52 (TIGR00607; HMM-score: 17.1)
    Cellular processesCellular processesAdaptations to atypical conditionstrehalose-phosphatase (TIGR00685; EC 3.1.3.12; HMM-score: 16.2)
    MetabolismAmino acid biosynthesisSerine familyphosphoserine phosphatase SerB (TIGR00338; EC 3.1.3.3; HMM-score: 15.4)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharides3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, YrbI family (TIGR01670; EC 3.1.3.45; HMM-score: 14.1)
    Unknown functionEnzymes of unknown specificityHAD phosphoserine phosphatase-like hydrolase, family IB (TIGR01488; HMM-score: 13.8)
  • TheSEED:
  • PFAM:
    HAD (CL0137) Hydrolase_3; haloacid dehalogenase-like hydrolase (PF08282; HMM-score: 173.7)
    S6PP; Sucrose-6F-phosphate phosphohydrolase (PF05116; HMM-score: 69.9)
    Hydrolase; haloacid dehalogenase-like hydrolase (PF00702; HMM-score: 21)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.098
    • Ymax_pos: 51
    • Cmax: 0.135
    • Cmax_pos: 51
    • Smax: 0.109
    • Smax_pos: 40
    • Smean: 0.075
    • D: 0.089
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446159673 NCBI
  • RefSeq: WP_000237528 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MVKAIAVDMDGTFLDSKKTYDKPRFEAIFTELRNRDITFIAASGNQYAKLKSIFGDRDMYFISENGAVIYKGNELYNYKSFNRQVFQQVVDYLNMNQSIDQLVICGLKSAYILKHTSEAFKEDTRFYYHQLKEIDSLQQLPEDDYVKIAFNINRETHPNVDEEVATQFSNDIKLVSSGHDSIDIIMPNMTKGQALKRLLDKWEMSPSELMAFGDANNDKDMLAFAKHSYVMENSHDEELFNIASAVAPSNDKQGVLTIIEQEVLNK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS13260 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]