⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_2620 [new locus tag: NWMN_RS06150 ]
- pan locus tag?: SAUPAN003441000
- symbol: NWMN_2620
- pan gene symbol?: psmβ2
- synonym: psmB2
- product: Phenol-soluble modulin beta 2
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_2620 [new locus tag: NWMN_RS06150 ]
- symbol: NWMN_2620
- product: Phenol-soluble modulin beta 2
- replicon: chromosome
- strand: +
- coordinates: 1188599..1188733
- length: 135
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121ATGACTGGACTAGCAGAAGCAATCGCAAATACTGTGCAAGCTGCACAACAACATGATAGT
GTGAAATTAGGCACAAGTATCGTAGACATCGTTGCTAACGGTGTGGGTTTACTAGGTAAA
TTATTTGGATTCTAA60
120
135
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_2620 [new locus tag: NWMN_RS06150 ]
- symbol: NWMN_2620
- description: Phenol-soluble modulin beta 2
- length: 44
- theoretical pI: 4.54462
- theoretical MW: 4496.17
- GRAVY: 0.570455
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED: data available for COL, NCTC8325, USA300_FPR3757
- PFAM:
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb:
- LocateP:
- SignalP:
- predicted transmembrane helices (TMHMM):
⊟Accession numbers[edit | edit source]
- GI: see NWMN_RS06150
- RefSeq: see NWMN_RS06150
- UniProt: A0A0H3KSC6 UniProt
⊟Protein sequence[edit | edit source]
- MEGLFNAIKDTVTAAINNDGAKLGTSIVSIVENGVGLLGKLFGF
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: AgrA (activation) regulon
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Shu Y Queck, Max Jameson-Lee, Amer E Villaruz, Thanh-Huy L Bach, Burhan A Khan, Daniel E Sturdevant, Stacey M Ricklefs, Min Li, Michael Otto
RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus.
Mol Cell: 2008, 32(1);150-8
[PubMed:18851841] [WorldCat.org] [DOI] (I p) - ↑ Tobias Geiger, Patrice Francois, Manuel Liebeke, Martin Fraunholz, Christiane Goerke, Bernhard Krismer, Jacques Schrenzel, Michael Lalk, Christiane Wolz
The stringent response of Staphylococcus aureus and its impact on survival after phagocytosis through the induction of intracellular PSMs expression.
PLoS Pathog: 2012, 8(11);e1003016
[PubMed:23209405] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]
Rong Wang, Kevin R Braughton, Dorothee Kretschmer, Thanh-Huy L Bach, Shu Y Queck, Min Li, Adam D Kennedy, David W Dorward, Seymour J Klebanoff, Andreas Peschel, Frank R DeLeo, Michael Otto
Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.
Nat Med: 2007, 13(12);1510-4
[PubMed:17994102] [WorldCat.org] [DOI] (I p)Shu Y Queck, Max Jameson-Lee, Amer E Villaruz, Thanh-Huy L Bach, Burhan A Khan, Daniel E Sturdevant, Stacey M Ricklefs, Min Li, Michael Otto
RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus.
Mol Cell: 2008, 32(1);150-8
[PubMed:18851841] [WorldCat.org] [DOI] (I p)Michael Otto
Staphylococcus aureus toxins.
Curr Opin Microbiol: 2014, 17;32-7
[PubMed:24581690] [WorldCat.org] [DOI] (I p)