From AureoWiki
Jump to navigation Jump to search
COLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40


Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: S354 [1]
  • symbol: S354
  • synonym:
  • product: RNA feature, intergenic transcript

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: misc_RNA
  • locus tag: S354 [1]
  • symbol: S354
  • product: RNA feature, intergenic transcript
  • replicon: chromosome
  • strand: +
  • coordinates: 818394..818490
  • length: 97
  • essential: unknown

Accession numbers[edit | edit source]

  • SRD:

Phenotype[edit | edit source]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    TCTTATTAATACAGTATCCATGAGATGTTCATCTATATATGATGAAAATGAACATTTATA
    CGAAATAGTAAATTTCATCAAGTAGGAGGAAAAAGTT
    60
    97

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator: PerR* (repression) regulon
    PerR*(TF)important in Oxidative stress response; RegPrecise    transcription unit transferred from N315 data RegPrecise 

Transcription pattern[edit | edit source]


Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.0 1.1 1.2 1.3 1.4 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]