Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_1396 [new locus tag: SAUSA300_RS07615 ]
- pan locus tag?: SAUPAN001825000
- symbol: SAUSA300_1396
- pan gene symbol?: —
- synonym:
- product: phiSLT ORF151-like protein, major tail protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_1396 [new locus tag: SAUSA300_RS07615 ]
- symbol: SAUSA300_1396
- product: phiSLT ORF151-like protein, major tail protein
- replicon: chromosome
- strand: -
- coordinates: 1564191..1564646
- length: 456
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3914271 NCBI
- RefSeq: YP_494093 NCBI
- BioCyc: GH3C-1391 BioCyc
- MicrobesOnline: 1292911 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421ATGACTAAAACTTTAAAGGTTTATAAAGGAGACGACGTCGTAGCTTCTGAACAAGGTGAA
GGCAAAGTGTCAGTAACTTTATCTAATTTAGAAGCGGATACAACTTATCCAAAAGGTACT
TACCAAGTGGCATGGGAAGAAAATGGTAAAGAATCTAGTAAAGTTGATGTACCTCAATTC
AAAACCAATCCAATTCTAGTCTCAGGCGTATCATTTACACCAGAAACTAAATCAATTATG
GTAAATACCGATGACAATGTTGAGCCAAACATTGCACCAAGCACAGCAACGAATAAAATA
TTGAAATATACAAGTGAACATCCAGAATTTGTTACTGTAGATGAAAATACAGGAGCAATT
CACGGTGTAGCTGAAGGTACTTCAGTAATCACTGCTATGTCTACTGATGGAAGCGATAAG
TCAGGACAAATTTCAGTGACAGTAACAAACGGATAG60
120
180
240
300
360
420
456
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_1396 [new locus tag: SAUSA300_RS07615 ]
- symbol: SAUSA300_1396
- description: phiSLT ORF151-like protein, major tail protein
- length: 151
- theoretical pI: 4.33262
- theoretical MW: 16032.6
- GRAVY: -0.435099
⊟Function[edit | edit source]
- TIGRFAM: isopropylmalate/isohomocitrate dehydrogenases (TIGR02088; HMM-score: 12.6)streptococcal pilin isopeptide linkage domain (TIGR03786; HMM-score: 11)
- TheSEED :
- Phage A118 gp13 protein homolog
- PFAM: E-set (CL0159) Big_2; Bacterial Ig-like domain (group 2) (PF02368; HMM-score: 36.2)and 2 morePur_ac_phosph_N; Purple acid Phosphatase, N-terminal domain (PF16656; HMM-score: 12.9)SprB; SprB repeat (PF13573; HMM-score: 8.2)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.025925
- TAT(Tat/SPI): 0.00154
- LIPO(Sec/SPII): 0.005576
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MTKTLKVYKGDDVVASEQGEGKVSVTLSNLEADTTYPKGTYQVAWEENGKESSKVDVPQFKTNPILVSGVSFTPETKSIMVNTDDNVEPNIAPSTATNKILKYTSEHPEFVTVDENTGAIHGVAEGTSVITAMSTDGSDKSGQISVTVTNG
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SAUSA300_0993 (pdhA) pyruvate dehydrogenase E1 component, alpha subunit [1] (data from MRSA252) SAUSA300_0995 branched-chain alpha-keto acid dehydrogenase subunit E2 [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)