Jump to navigation
Jump to search
NCBI: 01-DEC-2025
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_001043 [new locus tag: EGJ38_RS05210 ]
- pan locus tag?: SAUPAN003298000
- symbol: graF
- pan gene symbol?: graF
- synonym:
- alternate name: JSNZ_001043
- product: glycopeptide resistance-associated protein GraF
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_001043 [new locus tag: EGJ38_RS05210 ]
- symbol: graF
- product: glycopeptide resistance-associated protein GraF
- replicon: chromosome
- strand: -
- coordinates: 1048284..1048418
- length: 135
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq: MGT2423012 NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121ATGTCTAATGAAAATCAAAATAAAAAAGCAGCAGAAAAAGCTAAAGAAGTTGAAGAAAAA
TTAAAAGATAAAAAAGAAGAAAAAACAGAAGATATTAATCAAACAAAACAAGATATCCAA
GATACACTAAATTAA60
120
135
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_001043 [new locus tag: EGJ38_RS05210 ]
- symbol: GraF
- description: glycopeptide resistance-associated protein GraF
- length: 44
- theoretical pI: 4.75628
- theoretical MW: 5162.63
- GRAVY: -1.98409
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED: data available for COL, N315, NCTC8325
- PFAM: no clan defined DUF4665; Domain of unknown function (DUF4665) (PF15679; HMM-score: 14)and 3 morePinin_SDK_memA; pinin/SDK/memA/ protein conserved region (PF04696; HMM-score: 10.6)YtxH; YtxH-like protein (PF12732; HMM-score: 8.5)TBC-like (CL0816) RabGAP-TBC; Rab-GTPase-TBC domain (PF00566; HMM-score: 6.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.8401
- Cytoplasmic Membrane Score: 0.0005
- Cell wall & surface Score: 0.0245
- Extracellular Score: 0.1349
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.058847
- TAT(Tat/SPI): 0.013865
- LIPO(Sec/SPII): 0.021073
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: MGT2423012 NCBI
- UniProt:
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSNENQNKKAAEKAKEVEEKLKDKKEEKTEDINQTKQDIQDTLN
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]