From AureoWiki
Jump to navigation Jump to search

NCBI: 01-DEC-2025

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: EGJ38_001201 [new locus tag: EGJ38_RS06000 ]
  • pan locus tag?: SAUPAN003519000
  • symbol: acpP
  • pan gene symbol?: acpP
  • synonym:
  • alternate name: JSNZ_001201
  • product: acyl carrier protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: EGJ38_001201 [new locus tag: EGJ38_RS06000 ]
  • symbol: acpP
  • product: acyl carrier protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1205769..1206002
  • length: 234
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq: MGT2423166 NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    GTGGAAAATTTCGATAAAGTAAAAGATATCATCGTTGACCGTTTAGGTGTAGACGCTGAT
    AAAGTAACTGAAGATGCATCTTTCAAAGATGATTTAGGCGCTGACTCACTTGATATCGCT
    GAATTAGTAATGGAATTAGAAGACGAGTTTGGTACTGAAATTCCTGATGAAGAAGCTGAA
    AAAATCAACACTGTTGGTGATGCTGTTAAATTTATTAACAGTCTTGAAAAATAA
    60
    120
    180
    234

Protein[edit | edit source]

Protein Data Bank: 4DXE

General[edit | edit source]

  • locus tag: EGJ38_001201 [new locus tag: EGJ38_RS06000 ]
  • symbol: AcpP
  • description: acyl carrier protein
  • length: 77
  • theoretical pI: 3.72176
  • theoretical MW: 8549.37
  • GRAVY: -0.376623

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Fatty acid and phospholipid metabolism Biosynthesis acyl carrier protein (TIGR00517; HMM-score: 109.8)
    and 1 more
    Cellular processes Cellular processes Toxin production and resistance peptide maturation system acyl carrier-related protein (TIGR04069; HMM-score: 17.9)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    PP-binding (CL0314) PP-binding; Phosphopantetheine attachment site (PF00550; HMM-score: 61.4)
    and 4 more
    DUF7080; Domain of unknown function (DUF7080) (PF23297; HMM-score: 17.5)
    PP-binding_2; Acyl-carrier (PF14573; HMM-score: 16.4)
    Ribosomal_L50; Ribosomal subunit 39S (PF10501; HMM-score: 14.9)
    no clan defined Ribosomal_L12_N; Ribosomal protein L7/L12 dimerisation domain (PF16320; HMM-score: 13.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9868
    • Cytoplasmic Membrane Score: 0.0009
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.0121
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003188
    • TAT(Tat/SPI): 0.000506
    • LIPO(Sec/SPII): 0.00048
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: MGT2423166 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MENFDKVKDIIVDRLGVDADKVTEDASFKDDLGADSLDIAELVMELEDEFGTEIPDEEAEKINTVGDAVKFINSLEK

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]