Jump to navigation
Jump to search
NCBI: 22-FEB-2026
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_RS01595 [old locus tag: EGJ38_000319 ]
- pan locus tag?: SAUPAN001914000
- symbol: rpsF
- pan gene symbol?: rpsF
- synonym:
- product: 30S ribosomal protein S6
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_RS01595 [old locus tag: EGJ38_000319 ]
- symbol: rpsF
- product: 30S ribosomal protein S6
- replicon: chromosome
- strand: +
- coordinates: 356714..357010
- length: 297
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NZ_CM129921 (356714..357010) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241ATGAGAACATATGAAGTTATGTACATCGTACGCCCAAACATTGAGGAAGATGCTAAAAAA
GCGTTAGTTGAACGTTTCAACGGCATCTTAGCTACTGAAGGTGCAGAAGTTTTAGAAGCA
AAAGACTGGGGTAAACGTCGCCTAGCTTATGAAATCAATGATTTCAAAGATGGCTTCTAC
AACATCGTACGTGTTAAATCTGATAACAACAAAGCTACTGACGAATTCCAACGTCTAGCT
AAAATCAGTGACGATATCATTCGTTACATGGTTATTCGTGAAGACGAAGACAAGTAA60
120
180
240
297
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_RS01595 [old locus tag: EGJ38_000319 ]
- symbol: RpsF
- description: 30S ribosomal protein S6
- length: 98
- theoretical pI: 4.80116
- theoretical MW: 11595.1
- GRAVY: -0.690816
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein bS6 (TIGR00166; HMM-score: 102.9)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: no clan defined Ribosomal_S6; Ribosomal protein S6 (PF01250; HMM-score: 98.6)and 1 moreAbiJ_NTD3; AbiJ N-terminal domain 3 (PF18860; HMM-score: 15.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9415
- Cytoplasmic Membrane Score: 0.0001
- Cell wall & surface Score: 0
- Extracellular Score: 0.0583
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.006669
- TAT(Tat/SPI): 0.000556
- LIPO(Sec/SPII): 0.001577
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_001261460 NCBI
- UniProt:
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MRTYEVMYIVRPNIEEDAKKALVERFNGILATEGAEVLEAKDWGKRRLAYEINDFKDGFYNIVRVKSDNNKATDEFQRLAKISDDIIRYMVIREDEDK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: LexA see EGJ38_000319
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]