Jump to navigation
Jump to search
NCBI: 22-FEB-2026
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_RS01605 [old locus tag: EGJ38_000321 ]
- pan locus tag?: SAUPAN001916000
- symbol: rpsR
- pan gene symbol?: rpsR
- synonym:
- product: 30S ribosomal protein S18
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_RS01605 [old locus tag: EGJ38_000321 ]
- symbol: rpsR
- product: 30S ribosomal protein S18
- replicon: chromosome
- strand: +
- coordinates: 357586..357828
- length: 243
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NZ_CM129921 (357586..357828) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241ATGGCAGGTGGACCAAGAAGAGGCGGACGTCGTCGTAAAAAAGTATGCTATTTCACAGCA
AATGGTATTACACATATCGACTACAAAGACACTGAATTATTAAAACGTTTTATCTCAGAA
CGCGGTAAAATTTTACCACGTCGTGTAACTGGTACTTCAGCTAAATATCAACGTATGTTG
ACTACAGCTATCAAACGTTCTCGTCATATGGCATTATTACCATATGTTAAAGAAGAACAA
TAA60
120
180
240
243
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_RS01605 [old locus tag: EGJ38_000321 ]
- symbol: RpsR
- description: 30S ribosomal protein S18
- length: 80
- theoretical pI: 11.5763
- theoretical MW: 9309.89
- GRAVY: -0.78125
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein bS18 (TIGR00165; HMM-score: 126.6)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: HTH (CL0123) Ribosomal_S18; Ribosomal protein S18 (PF01084; HMM-score: 100.6)and 1 moreno clan defined SpoVIF; Stage VI sporulation protein F (PF14069; HMM-score: 13.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.67
- Cytoplasmic Membrane Score: 0.01
- Cellwall Score: 0.15
- Extracellular Score: 0.17
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.8662
- Cytoplasmic Membrane Score: 0.0017
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.132
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.009082
- TAT(Tat/SPI): 0.006745
- LIPO(Sec/SPII): 0.00536
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_000897044 NCBI
- UniProt:
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MAGGPRRGGRRRKKVCYFTANGITHIDYKDTELLKRFISERGKILPRRVTGTSAKYQRMLTTAIKRSRHMALLPYVKEEQ
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: LexA see EGJ38_000321
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]