Jump to navigation
Jump to search
NCBI: 22-FEB-2026
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_RS04135 [old locus tag: EGJ38_000828 ]
- pan locus tag?: SAUPAN002948000
- symbol: EGJ38_RS04135
- pan gene symbol?: —
- synonym:
- product: DUF3269 family protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_RS04135 [old locus tag: EGJ38_000828 ]
- symbol: EGJ38_RS04135
- product: DUF3269 family protein
- replicon: chromosome
- strand: +
- coordinates: 847236..847457
- length: 222
- essential: unknown
⊟Accession numbers[edit | edit source]
- Location: NZ_CM129921 (847236..847457) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181ATGCCGAAAGAAAAATATTACTTATACCGAGAAGATGGCACAGAAGATATTAAGGTCATC
AAGTATAAAGAGAATGAGAATGAAGTTTATTCGCTCACAGGAGCCCATTTCAGCGACGAA
AAGAAAATTATGACTGATAGTGACCTAAAACGATTTAAAGGCGCTCACGGACTTCTATAT
GAGCAAGAGCTAGGTTTACAAGCAACGATATTTGATATTTAG60
120
180
222
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_RS04135 [old locus tag: EGJ38_000828 ]
- symbol: EGJ38_RS04135
- description: DUF3269 family protein
- length: 73
- theoretical pI: 4.84356
- theoretical MW: 8595.63
- GRAVY: -0.80137
⊟Function[edit | edit source]
- TIGRFAM: DNA metabolism DNA replication, recombination, and repair DNA mismatch repair endonuclease MutH (TIGR02248; HMM-score: 11.6)
- TheSEED:
- PFAM: no clan defined DUF3269; Protein of unknown function (DUF3269) (PF11673; HMM-score: 173.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.8267
- Cytoplasmic Membrane Score: 0.024
- Cell wall & surface Score: 0.0004
- Extracellular Score: 0.1489
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.004378
- TAT(Tat/SPI): 0.000672
- LIPO(Sec/SPII): 0.000604
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_001123695 NCBI
- UniProt:
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MPKEKYYLYREDGTEDIKVIKYKENENEVYSLTGAHFSDEKKIMTDSDLKRFKGAHGLLYEQELGLQATIFDI
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]