From AureoWiki
Jump to navigation Jump to search

NCBI: 22-FEB-2026

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: EGJ38_RS13265 [old locus tag: EGJ38_002657 ]
  • pan locus tag?: SAUPAN006412000
  • symbol: icaD
  • pan gene symbol?: icaD
  • synonym:
  • product: intracellular adhesion protein IcaD

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: EGJ38_RS13265 [old locus tag: EGJ38_002657 ]
  • symbol: icaD
  • product: intracellular adhesion protein IcaD
  • replicon: chromosome
  • strand: +
  • coordinates: 2675874..2676179
  • length: 306
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Location: NZ_CM129921 (2675874..2676179) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    ATGGTCAAGCCCAGACAGAGGGAATACCCAACGCTAAAATCATCGCTAAATATTGTAAGA
    GAAACAGCACTTATCGCTATATCTTGTGTCTTTTGGATATATTGTTTAGTTGTTCTACTC
    GTTTATATTGGTACTATATTTGAAATTCATGACGAAAGTATCAATACAATACGTGTTGCT
    TTAAACATTGAAAATACTGAAATTTTAGATATATTTGAAACTATGGGCATTTTCGCGATT
    ATCATTTTTGTATTTTTTACAATTAGCATATTGATTCAAAAATGGCAGAGAGGAAGAGAA
    TCGTGA
    60
    120
    180
    240
    300
    306


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: EGJ38_RS13265 [old locus tag: EGJ38_002657 ]
  • symbol: IcaD
  • description: intracellular adhesion protein IcaD
  • length: 101
  • theoretical pI: 5.82065
  • theoretical MW: 11782.9
  • GRAVY: 0.670297

Function[edit | edit source]

  • TIGRFAM:
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides intracellular adhesion protein D (TIGR03932; HMM-score: 132.7)
    and 2 more
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides oligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 14.1)
    integral membrane protein (TIGR04561; HMM-score: 5)
  • TheSEED: data available for COL, N315, NCTC8325, Newman
  • PFAM:
    APC (CL0062) Spore_permease; Spore germination protein (PF03845; HMM-score: 19.1)
    and 4 more
    Transporter (CL0375) TMEM127; Transmembrane protein 127 (PF20517; HMM-score: 14.2)
    TrbL (CL0698) TrbL_4; Conjugal transfer protein TrbL (PF19597; HMM-score: 13.2)
    no clan defined DUF1456; Protein of unknown function (DUF1456) (PF07308; HMM-score: 12.6)
    DUF2207_C; Predicted membrane protein (DUF2207) C-terminal domain (PF20990; HMM-score: 11.3)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 2
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.9886
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0113
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.000853
    • TAT(Tat/SPI): 0.000208
    • LIPO(Sec/SPII): 0.023432
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: WP_000240580 NCBI
  • UniProt:

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MVKPRQREYPTLKSSLNIVRETALIAISCVFWIYCLVVLLVYIGTIFEIHDESINTIRVALNIENTEILDIFETMGIFAIIIFVFFTISILIQKWQRGRES

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]


Relevant publications[edit | edit source]