Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_002266
- pan locus tag?: SAUPAN005768000
- symbol: JSNZ_002266
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS, pseudogene
- locus tag: JSNZ_002266
- symbol: JSNZ_002266
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 2262545..2262786
- length: 242
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241ATGACTAAATTAATTGAGAATTTGAAGGCAAGTATATTTGTAAGTACTTTAACTAAAAAT
TTATCAATGTATAGCCGATTTGACATGCCTAAATTTGGGTGTGTCAATGGCTGTATGTTG
TTTATTCTTTATTACAGAGTGAATCGGATTGGTGAAAATCGAAATTTTGAGATTTTTACC
AATTCGATTTTTTCATAGAAATTAAAAAAGCCAACAAGGCTCTTGAAACCTTGTTGGCGT
AA60
120
180
240
242
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_002266
- symbol: JSNZ_002266
- description: hypothetical protein
- length:
- theoretical pI:
- theoretical MW:
- GRAVY:
⊟Function[edit | edit source]
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb:
- DeepLocPro:
- LocateP:
- SignalP:
- predicted transmembrane helices (TMHMM):
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: SigB (activation) regulon
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
J Bacteriol: 2004, 186(13);4085-99
[PubMed:15205410] [WorldCat.org] [DOI] (P p) - ↑ Jan Pané-Farré, Beate Jonas, Konrad Förstner, Susanne Engelmann, Michael Hecker
The sigmaB regulon in Staphylococcus aureus and its regulation.
Int J Med Microbiol: 2006, 296(4-5);237-58
[PubMed:16644280] [WorldCat.org] [DOI] (P p) - ↑ Bettina Schulthess, Dominik A Bloes, Patrice François, Myriam Girard, Jacques Schrenzel, Markus Bischoff, Brigitte Berger-Bächi
The σB-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus.
J Bacteriol: 2011, 193(18);4954-62
[PubMed:21725011] [WorldCat.org] [DOI] (I p)