From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1403 [new locus tag: NWMN_RS07920 ]
  • pan locus tag?: SAUPAN004028000
  • symbol: NWMN_1403
  • pan gene symbol?: scpA
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_1403 [new locus tag: NWMN_RS07920 ]
  • symbol: NWMN_1403
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1572387..1573142
  • length: 756
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGACGCAATACGAGGTAGATATTATGTATGAAGTTAAATTAGATGCTTTCAATGGACCA
    TTAGATTTATTGCTGCATCTTATCCAAAAATTTGAAATAGATATTTATGATATTCCTATG
    CAAGCATTAACAGAGCAGTATATGCAGTACGTTCATGCAATGAAACAGCTTGAAATTAAT
    ATTGCAAGTGAATACCTAGTATTAGCGTCAGAACTCTTAATGATTAAAAGTAAGATGCTA
    TTACCACAATCAACATCAGATATGGATGTTGATGATGACCCACGGGAAGATTTAGTTGGG
    CGTTTAATAGAATATCAAAATTATAAAGAATATACTGCTATTTTAAATGACATGAAAGAA
    GAAAGAGATTTTTATTTTACAAAAAGACCGACAGATTTATCTCATTTGGAAACAGATGAA
    TCTTGGGATCCAAATCATACGATTGATTTAACTGAATTAATTGTAGCTTATCAAAGAGTT
    AAAAATAGAGTTGAGTTAAATACACCTAAATCTGTTGAAATCCGAAAAGAGACATTTACC
    ATTCAACAAGCTACAGAACAAGTGACATCGAGATTGAAAGATAAAGATCATTTTAACTTC
    TTTAGTCTGTTTACGTTTTCTGAGCCAATTGAACAAGTAGTCACTCACTTTTTAGCTATT
    TTAGAGATGTCAAAAGCAGGAATAATTAATATTGAGCAACAACGTAATTTTGAAGATATT
    AACATTATTAGAGGAGTGAACTACCATTTTGGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    756

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_1403 [new locus tag: NWMN_RS07920 ]
  • symbol: NWMN_1403
  • description: hypothetical protein
  • length: 251
  • theoretical pI: 4.3952
  • theoretical MW: 29650.5
  • GRAVY: -0.368924

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:  
    Cell Division and Cell Cycle Cell Division and Cell Cycle - no subcategory Two cell division clusters relating to chromosome partitioning  Segregation and condensation protein A
  • PFAM:
    Kleisin (CL0157) SMC_ScpA; Segregation and condensation protein ScpA (PF02616; HMM-score: 121.8)
    and 2 more
    Rad21_Rec8; Conserved region of Rad21 / Rec8 like protein (PF04824; HMM-score: 14.9)
    no clan defined EB1; EB1-like C-terminal motif (PF03271; HMM-score: 12.1)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002163
    • TAT(Tat/SPI): 0.000073
    • LIPO(Sec/SPII): 0.00017
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTQYEVDIMYEVKLDAFNGPLDLLLHLIQKFEIDIYDIPMQALTEQYMQYVHAMKQLEINIASEYLVLASELLMIKSKMLLPQSTSDMDVDDDPREDLVGRLIEYQNYKEYTAILNDMKEERDFYFTKRPTDLSHLETDESWDPNHTIDLTELIVAYQRVKNRVELNTPKSVEIRKETFTIQQATEQVTSRLKDKDHFNFFSLFTFSEPIEQVVTHFLAILEMSKAGIINIEQQRNFEDINIIRGVNYHFG

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]