From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1688
  • pan locus tag?: SAUPAN004513000
  • symbol: NWMN_1688
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_1688
  • symbol: NWMN_1688
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1883505..1883957
  • length: 453
  • essential: unknown

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGAAAATAACATATAAATATAGAGGAGATTTACCTTTGAATACAGAGAACAACAAGAAT
    CAAAACCAATCTGTTAAAAATTCTGAAAGACGCGGCATGTTAAAAGGATGCGGCGGTTGC
    CTTATTTCTTTTATTTTATTAATAATCTTATTATCAGCCTGTTCAATGATGTTTAGTAAT
    AATGACAATTCCACTAATAATCAATCATCAAAAACGCAATTAACTCAAAAAGATGAAAAT
    AAAAATGAAGATAAGCCTGAGGAAAAATCAGAAACAGCAACAGATGAGGATTTACAATCA
    ACCGAAGAAGTACCTGCAAATGAAAATACTGAAAATAATCAACATGAAATTGATGAAATA
    ACAACAAAAGATCAATCAGACGATGATATTAACACACCAAACGTTGCAGAAGATAAATCA
    CAAGACGACTTGAAAGATGATTTAAAAGAATAG
    60
    120
    180
    240
    300
    360
    420
    453


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_1688
  • symbol: NWMN_1688
  • description: hypothetical protein
  • length: 150
  • theoretical pI: 4.12325
  • theoretical MW: 16965.3
  • GRAVY: -1.26

Function[edit | edit source]

  • TIGRFAM:
    TIGR03943 family protein (TIGR03943; HMM-score: 14.9)
    Metabolism Transport and binding proteins Nucleosides, purines and pyrimidines nucleoside Transporter (TIGR00939; HMM-score: 14.1)
    Cellular processes Cellular processes Sporulation and germination stage III sporulation protein AG (TIGR02830; HMM-score: 14.1)
    Cellular processes Cellular processes Pathogenesis type III secretion protein, HrcV family (TIGR01399; HMM-score: 13.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion protein, HrcV family (TIGR01399; HMM-score: 13.8)
    Cellular processes Cellular processes Cell division cell division protein FtsL (TIGR02209; HMM-score: 13.3)
    and 6 more
    Cellular processes Cellular processes Sporulation and germination stage III sporulation protein AF (TIGR02896; HMM-score: 10.5)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 8.8)
    Cellular processes Cellular processes Sporulation and germination sporulation lipoprotein, YhcN/YlaJ family (TIGR02898; HMM-score: 7.2)
    mycoides cluster lipoprotein, LppA/P72 family (TIGR03490; HMM-score: 5.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion protein EssA (TIGR03927; HMM-score: 4.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin cobaltochelatase, CobT subunit (TIGR01651; EC 6.6.1.2; HMM-score: 3.4)
  • TheSEED  :
    • Hypothetical protein SAV1799
  • PFAM:
    no clan defined PFF1_TM; Vacuolar membrane protease, transmembrane domain (PF22251; HMM-score: 18)
    GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 16.7)
    no clan defined DUF5850; Family of unknown function (DUF5850) (PF19168; HMM-score: 16.2)
    MAP17; Membrane-associated protein 117 kDa, PDZK1-interacting protein 1 (PF15807; HMM-score: 15.9)
    DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 15.6)
    no clan defined SARAF; SOCE-associated regulatory factor of calcium homoeostasis (PF06682; HMM-score: 15.3)
    TMEM51; Transmembrane protein 51 (PF15345; HMM-score: 15.2)
    and 19 more
    FAM176; FAM176 family (PF14851; HMM-score: 14)
    MFS (CL0015) SLC52_ribofla_tr; Solute carrier family 52, riboflavin transporter (PF06237; HMM-score: 13.8)
    no clan defined V_ATPase_I; V-type ATPase 116kDa subunit family (PF01496; HMM-score: 13.5)
    CRA; Circumsporozoite-related antigen (CRA) (PF06589; HMM-score: 12.6)
    Piezo_TM1-24; Piezo TM1-24 (PF24871; HMM-score: 12.1)
    G0-G1_switch_2; G0/G1 switch protein 2 (PF15103; HMM-score: 12)
    DDHD; DDHD domain (PF02862; HMM-score: 11.1)
    Transporter (CL0375) Connexin; Connexin (PF00029; HMM-score: 10.6)
    O-anti_assembly (CL0499) O-antigen_lig; O-antigen ligase like membrane protein (PF13425; HMM-score: 10.6)
    no clan defined Ac45-VOA1_TM; V0 complex accessory subunit Ac45/VOA1 transmembrane domain (PF20520; HMM-score: 10.3)
    Serinc; Serine incorporator (Serinc) (PF03348; HMM-score: 10.2)
    DUF4820; Domain of unknown function (DUF4820) (PF16091; HMM-score: 10)
    DUF4834; Domain of unknown function (DUF4834) (PF16118; HMM-score: 9.5)
    Nucleoplasmin (CL0055) TT_ORF1; TT viral orf 1 (PF02956; HMM-score: 9.4)
    DMT (CL0184) Ureide_permease; Ureide permease (PF07168; HMM-score: 9.2)
    no clan defined Neur_chan_memb; Neurotransmitter-gated ion-channel transmembrane region (PF02932; HMM-score: 8.9)
    MFS (CL0015) Folate_carrier; Reduced folate carrier (PF01770; HMM-score: 8.7)
    no clan defined DUF6556; Family of unknown function (DUF6556) (PF20193; HMM-score: 8.2)
    NPR (CL0435) NPR3; Nitrogen Permease regulator of amino acid transport activity 3 (PF03666; HMM-score: 7.6)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.6633
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.3366
  • LocateP: Lipid anchored
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPII)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: LLSACSM
  • SignalP: Signal peptide LIPO(Sec/SPII) length 53 aa
    • SP(Sec/SPI): 0.043276
    • TAT(Tat/SPI): 0.0134
    • LIPO(Sec/SPII): 0.689809
    • Cleavage Site: CS pos: 53-54. LSA-CS. Pr: 0.6043
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MKITYKYRGDLPLNTENNKNQNQSVKNSERRGMLKGCGGCLISFILLIILLSACSMMFSNNDNSTNNQSSKTQLTQKDENKNEDKPEEKSETATDEDLQSTEEVPANENTENNQHEIDEITTKDQSDDDINTPNVAEDKSQDDLKDDLKE

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]


Relevant publications[edit | edit source]