From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 06-JUL-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1688
  • pan locus tag?: SAUPAN004513000
  • symbol: NWMN_1688
  • pan gene symbol?: —
  • synonym:
  • product: hypothetical protein

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_1688
  • symbol: NWMN_1688
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1883505..1883957
  • length: 453
  • essential: unknown

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    ATGAAAATAACATATAAATATAGAGGAGATTTACCTTTGAATACAGAGAACAACAAGAAT
    CAAAACCAATCTGTTAAAAATTCTGAAAGACGCGGCATGTTAAAAGGATGCGGCGGTTGC
    CTTATTTCTTTTATTTTATTAATAATCTTATTATCAGCCTGTTCAATGATGTTTAGTAAT
    AATGACAATTCCACTAATAATCAATCATCAAAAACGCAATTAACTCAAAAAGATGAAAAT
    AAAAATGAAGATAAGCCTGAGGAAAAATCAGAAACAGCAACAGATGAGGATTTACAATCA
    ACCGAAGAAGTACCTGCAAATGAAAATACTGAAAATAATCAACATGAAATTGATGAAATA
    ACAACAAAAGATCAATCAGACGATGATATTAACACACCAAACGTTGCAGAAGATAAATCA
    CAAGACGACTTGAAAGATGATTTAAAAGAATAG
    60
    120
    180
    240
    300
    360
    420
    453

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: NWMN_1688
  • symbol: NWMN_1688
  • description: hypothetical protein
  • length: 150
  • theoretical pI: 4.12325
  • theoretical MW: 16965.3
  • GRAVY: -1.26

⊟Function[edit | edit source]

  • TIGRFAM:
    TIGR03943 family protein (TIGR03943; HMM-score: 14.9)
    Metabolism Transport and binding proteins Nucleosides, purines and pyrimidines nucleoside Transporter (TIGR00939; HMM-score: 14.1)
    Cellular processes Cellular processes Sporulation and germination stage III sporulation protein AG (TIGR02830; HMM-score: 14.1)
    Cellular processes Cellular processes Pathogenesis type III secretion protein, HrcV family (TIGR01399; HMM-score: 13.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion protein, HrcV family (TIGR01399; HMM-score: 13.8)
    Cellular processes Cellular processes Cell division cell division protein FtsL (TIGR02209; HMM-score: 13.3)
    and 6 more
    Cellular processes Cellular processes Sporulation and germination stage III sporulation protein AF (TIGR02896; HMM-score: 10.5)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 8.8)
    Cellular processes Cellular processes Sporulation and germination sporulation lipoprotein, YhcN/YlaJ family (TIGR02898; HMM-score: 7.2)
    mycoides cluster lipoprotein, LppA/P72 family (TIGR03490; HMM-score: 5.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion protein EssA (TIGR03927; HMM-score: 4.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin cobaltochelatase, CobT subunit (TIGR01651; EC 6.6.1.2; HMM-score: 3.4)
  • TheSEED:
  • PFAM:
    no clan defined DUF1510; Protein of unknown function (DUF1510) (PF07423; HMM-score: 20.5)
    CRA; Circumsporozoite-related antigen (CRA) (PF06589; HMM-score: 19.4)
    DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 17.5)
    no clan defined DUF4692; Domain of unknown function (DUF4692) (PF15763; HMM-score: 17)
    GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 16.9)
    O-anti_assembly (CL0499) O-antigen_lig; O-antigen ligase like membrane protein (PF13425; HMM-score: 16.5)
    and 20 more
    no clan defined TMEM51; Transmembrane protein 51 (PF15345; HMM-score: 15.9)
    SARAF; SOCE-associated regulatory factor of calcium homoeostasis (PF06682; HMM-score: 15.7)
    Piezo_RRas_bdg; Piezo non-specific cation channel, R-Ras-binding domain (PF12166; HMM-score: 14.3)
    MAP17; Membrane-associated protein 117 kDa, PDZK1-interacting protein 1 (PF15807; HMM-score: 12.7)
    Serinc; Serine incorporator (Serinc) (PF03348; HMM-score: 12.3)
    G0-G1_switch_2; G0/G1 switch protein 2 (PF15103; HMM-score: 11.9)
    FAM176; FAM176 family (PF14851; HMM-score: 11.7)
    V_ATPase_I; V-type ATPase 116kDa subunit family (PF01496; HMM-score: 11.4)
    DUF4834; Domain of unknown function (DUF4834) (PF16118; HMM-score: 10.9)
    CLN3; CLN3 protein (PF02487; HMM-score: 10.4)
    DMT (CL0184) CSG2; Ceramide synthase regulator (PF16965; HMM-score: 10)
    no clan defined TRAP_alpha; Translocon-associated protein (TRAP), alpha subunit (PF03896; HMM-score: 9.7)
    DUF4820; Domain of unknown function (DUF4820) (PF16091; HMM-score: 9.7)
    Viral_ssRNA_CP (CL0055) TT_ORF1; TT viral orf 1 (PF02956; HMM-score: 9.5)
    Peptidase_AD (CL0130) Presenilin; Presenilin (PF01080; HMM-score: 9.3)
    DMT (CL0184) Ureide_permease; Ureide permease (PF07168; HMM-score: 9.1)
    APC (CL0062) HCO3_cotransp; HCO3- transporter family (PF00955; HMM-score: 8.8)
    NPR (CL0435) NPR3; Nitrogen Permease regulator of amino acid transport activity 3 (PF03666; HMM-score: 8.6)
    MFS (CL0015) Folate_carrier; Reduced folate carrier (PF01770; HMM-score: 8.1)
    FUSC (CL0307) ALMT; Aluminium activated malate transporter (PF11744; HMM-score: 5.1)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • LocateP: Lipid anchored
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPII)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: LLSACSM
  • SignalP: Signal peptide LIPO(Sec/SPII) length 53 aa
    • SP(Sec/SPI): 0.043276
    • TAT(Tat/SPI): 0.0134
    • LIPO(Sec/SPII): 0.689809
    • Cleavage Site: CS pos: 53-54. LSA-CS. Pr: 0.6043
  • predicted transmembrane helices (TMHMM): 1

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MKITYKYRGDLPLNTENNKNQNQSVKNSERRGMLKGCGGCLISFILLIILLSACSMMFSNNDNSTNNQSSKTQLTQKDENKNEDKPEEKSETATDEDLQSTEEVPANENTENNQHEIDEITTKDQSDDDINTPNVAEDKSQDDLKDDLKE

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

⊟Relevant publications[edit | edit source]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=NWMN_1688&oldid=67448"