Jump to navigation
Jump to search
NCBI: 06-JUL-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_1688
- pan locus tag?: SAUPAN004513000
- symbol: NWMN_1688
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_1688
- symbol: NWMN_1688
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 1883505..1883957
- length: 453
- essential: unknown
⊟Accession numbers[edit | edit source]
- Gene ID: 5331000 NCBI
- RefSeq: YP_001332722 NCBI
- BioCyc:
- MicrobesOnline: 3707240 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421ATGAAAATAACATATAAATATAGAGGAGATTTACCTTTGAATACAGAGAACAACAAGAAT
CAAAACCAATCTGTTAAAAATTCTGAAAGACGCGGCATGTTAAAAGGATGCGGCGGTTGC
CTTATTTCTTTTATTTTATTAATAATCTTATTATCAGCCTGTTCAATGATGTTTAGTAAT
AATGACAATTCCACTAATAATCAATCATCAAAAACGCAATTAACTCAAAAAGATGAAAAT
AAAAATGAAGATAAGCCTGAGGAAAAATCAGAAACAGCAACAGATGAGGATTTACAATCA
ACCGAAGAAGTACCTGCAAATGAAAATACTGAAAATAATCAACATGAAATTGATGAAATA
ACAACAAAAGATCAATCAGACGATGATATTAACACACCAAACGTTGCAGAAGATAAATCA
CAAGACGACTTGAAAGATGATTTAAAAGAATAG60
120
180
240
300
360
420
453
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_1688
- symbol: NWMN_1688
- description: hypothetical protein
- length: 150
- theoretical pI: 4.12325
- theoretical MW: 16965.3
- GRAVY: -1.26
⊟Function[edit | edit source]
- TIGRFAM: TIGR03943 family protein (TIGR03943; HMM-score: 14.9)Transport and binding proteins Nucleosides, purines and pyrimidines nucleoside Transporter (TIGR00939; HMM-score: 14.1)Cellular processes Sporulation and germination stage III sporulation protein AG (TIGR02830; HMM-score: 14.1)Cellular processes Pathogenesis type III secretion protein, HrcV family (TIGR01399; HMM-score: 13.8)Protein fate Protein and peptide secretion and trafficking type III secretion protein, HrcV family (TIGR01399; HMM-score: 13.8)Cellular processes Cell division cell division protein FtsL (TIGR02209; HMM-score: 13.3)and 6 moreCellular processes Sporulation and germination stage III sporulation protein AF (TIGR02896; HMM-score: 10.5)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 8.8)Cellular processes Sporulation and germination sporulation lipoprotein, YhcN/YlaJ family (TIGR02898; HMM-score: 7.2)mycoides cluster lipoprotein, LppA/P72 family (TIGR03490; HMM-score: 5.6)Protein fate Protein and peptide secretion and trafficking type VII secretion protein EssA (TIGR03927; HMM-score: 4.6)Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin cobaltochelatase, CobT subunit (TIGR01651; EC 6.6.1.2; HMM-score: 3.4)
- TheSEED :
- Hypothetical protein SAV1799
- PFAM: no clan defined PFF1_TM; Vacuolar membrane protease, transmembrane domain (PF22251; HMM-score: 18)GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 16.7)no clan defined DUF5850; Family of unknown function (DUF5850) (PF19168; HMM-score: 16.2)MAP17; Membrane-associated protein 117 kDa, PDZK1-interacting protein 1 (PF15807; HMM-score: 15.9)DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 15.6)no clan defined SARAF; SOCE-associated regulatory factor of calcium homoeostasis (PF06682; HMM-score: 15.3)TMEM51; Transmembrane protein 51 (PF15345; HMM-score: 15.2)and 19 moreFAM176; FAM176 family (PF14851; HMM-score: 14)MFS (CL0015) SLC52_ribofla_tr; Solute carrier family 52, riboflavin transporter (PF06237; HMM-score: 13.8)no clan defined V_ATPase_I; V-type ATPase 116kDa subunit family (PF01496; HMM-score: 13.5)CRA; Circumsporozoite-related antigen (CRA) (PF06589; HMM-score: 12.6)Piezo_TM1-24; Piezo TM1-24 (PF24871; HMM-score: 12.1)G0-G1_switch_2; G0/G1 switch protein 2 (PF15103; HMM-score: 12)DDHD; DDHD domain (PF02862; HMM-score: 11.1)Transporter (CL0375) Connexin; Connexin (PF00029; HMM-score: 10.6)O-anti_assembly (CL0499) O-antigen_lig; O-antigen ligase like membrane protein (PF13425; HMM-score: 10.6)no clan defined Ac45-VOA1_TM; V0 complex accessory subunit Ac45/VOA1 transmembrane domain (PF20520; HMM-score: 10.3)Serinc; Serine incorporator (Serinc) (PF03348; HMM-score: 10.2)DUF4820; Domain of unknown function (DUF4820) (PF16091; HMM-score: 10)DUF4834; Domain of unknown function (DUF4834) (PF16118; HMM-score: 9.5)Nucleoplasmin (CL0055) TT_ORF1; TT viral orf 1 (PF02956; HMM-score: 9.4)DMT (CL0184) Ureide_permease; Ureide permease (PF07168; HMM-score: 9.2)no clan defined Neur_chan_memb; Neurotransmitter-gated ion-channel transmembrane region (PF02932; HMM-score: 8.9)MFS (CL0015) Folate_carrier; Reduced folate carrier (PF01770; HMM-score: 8.7)no clan defined DUF6556; Family of unknown function (DUF6556) (PF20193; HMM-score: 8.2)NPR (CL0435) NPR3; Nitrogen Permease regulator of amino acid transport activity 3 (PF03666; HMM-score: 7.6)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helix: 1
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.6633
- Cell wall & surface Score: 0
- Extracellular Score: 0.3366
- LocateP: Lipid anchored
- Prediction by SwissProt Classification: Extracellular
- Pathway Prediction: Sec-(SPII)
- Intracellular possibility: 0.17
- Signal peptide possibility: -0.5
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: LLSACSM
- SignalP: Signal peptide LIPO(Sec/SPII) length 53 aa
- SP(Sec/SPI): 0.043276
- TAT(Tat/SPI): 0.0134
- LIPO(Sec/SPII): 0.689809
- Cleavage Site: CS pos: 53-54. LSA-CS. Pr: 0.6043
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKITYKYRGDLPLNTENNKNQNQSVKNSERRGMLKGCGGCLISFILLIILLSACSMMFSNNDNSTNNQSSKTQLTQKDENKNEDKPEEKSETATDEDLQSTEEVPANENTENNQHEIDEITTKDQSDDDINTPNVAEDKSQDDLKDDLKE
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]